ID: 918354734

View in Genome Browser
Species Human (GRCh38)
Location 1:183696850-183696872
Sequence GGCAAGAATTGGTCAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 17, 3: 74, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918354734 Original CRISPR GGCAAGAATTGGTCAGATTC TGG (reversed) Intronic
900666452 1:3818478-3818500 GGCGAGAAGTGGTCAGATTCTGG - Intronic
900848289 1:5121250-5121272 GGTGAGAAGTGGTCAAATTCTGG - Intergenic
902087391 1:13874038-13874060 GGCCAGGTTTGATCAGATTCCGG + Intergenic
904106647 1:28090361-28090383 GGCAGTAAATGGTCAGGTTCTGG - Intergenic
904257876 1:29267915-29267937 GGGGAGAAGTGGTCAGATTCTGG + Intronic
904632979 1:31856984-31857006 GGTAAGAAATGGCCAGATTCTGG + Intergenic
905190675 1:36231877-36231899 TTGAGGAATTGGTCAGATTCCGG + Intronic
906158276 1:43627186-43627208 GGAGAGAAGTGGCCAGATTCTGG + Intergenic
906447905 1:45919208-45919230 GATAAGAAGTGGTCAGATTTGGG + Intronic
906750616 1:48255927-48255949 GCCAAGAATGGGACAGAGTCAGG + Intergenic
907703956 1:56816924-56816946 GGCTAGAAGTGGTCAGATGCTGG - Intronic
907778416 1:57541789-57541811 GGCAAGAATTAGTAAGACTATGG - Intronic
907804612 1:57805845-57805867 GGTGAGAAATGGTCAGATTCTGG - Intronic
907816310 1:57921609-57921631 GGCAAGAAGTGATCTGATTCTGG - Intronic
907877293 1:58503957-58503979 GGAAAGAATCAGTCAGATTCTGG - Intronic
908316407 1:62937136-62937158 GGTGAGAAGTGGTCAGCTTCTGG + Intergenic
908670906 1:66546583-66546605 AGCAAGAATTGCTTAGATTAAGG + Intronic
909544954 1:76836026-76836048 GGAAAGAATTGGGCAATTTCAGG + Intergenic
909840340 1:80313161-80313183 GGCCAGAATTGGTTAATTTCTGG + Intergenic
910170647 1:84373104-84373126 GGCAAGGATTGGGGACATTCCGG + Intronic
910211773 1:84800760-84800782 TGTGAGAAGTGGTCAGATTCTGG + Intergenic
910623401 1:89280841-89280863 GCCAAAAAGTGGTCAGAGTCTGG - Intergenic
911224680 1:95292033-95292055 AGCAAGAAATGGCCAGATTCTGG + Intergenic
912111977 1:106354561-106354583 GACAAGATGTGGTCAAATTCAGG + Intergenic
912788624 1:112628886-112628908 GGTAAGAAATAGTCAAATTCTGG - Intronic
913697531 1:121341925-121341947 GGTGAGAAGTGGTCAAATTCTGG + Intronic
914140028 1:144938127-144938149 GGTGAGAAGTGGTCAAATTCTGG - Intronic
914910870 1:151785325-151785347 GAGAAAAAGTGGTCAGATTCTGG - Intronic
915964766 1:160296853-160296875 GGTGAGCAGTGGTCAGATTCAGG - Intronic
916644485 1:166769528-166769550 GAGAAGAATTGCTCATATTCAGG - Intergenic
917235091 1:172883352-172883374 GGCAAGAATGGGCCAACTTCTGG + Intergenic
917402038 1:174660471-174660493 GGCAAGAAATAATAAGATTCTGG - Intronic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
918391410 1:184067218-184067240 GGTAAGAAATGGACAGATTCTGG - Intronic
918503834 1:185229245-185229267 GATAAGAATTGGTCAAATGCTGG + Intronic
919673783 1:200361551-200361573 GGTGAGAAGTGGGCAGATTCTGG - Intergenic
920484920 1:206360574-206360596 GGTGAGAAGTGGTCAAATTCTGG + Intronic
921527811 1:216239792-216239814 GGCAAGAAGTGGTCAAATTCTGG + Intronic
921544158 1:216454266-216454288 GGCATCACTTGGTCAGATTTAGG - Intergenic
922612055 1:226938096-226938118 GGCTAGAGTTCGTAAGATTCAGG + Intronic
923402220 1:233626158-233626180 GATGAGAAGTGGTCAGATTCTGG + Intronic
924073539 1:240308742-240308764 GCTGAGAAGTGGTCAGATTCTGG + Intronic
1063060980 10:2552391-2552413 GTCAAGGAGTGGTCAAATTCTGG - Intergenic
1063309056 10:4935840-4935862 GATGAGAAATGGTCAGATTCTGG + Intronic
1063333767 10:5188793-5188815 GAGGAGAAGTGGTCAGATTCTGG + Intergenic
1063925899 10:10977068-10977090 GTCAAGAATTGGTCTAAATCAGG - Intergenic
1064186223 10:13163991-13164013 GGTGAGAAATGGTCAGATTCTGG + Intronic
1064334015 10:14422302-14422324 GGTAAGAAATGGTCAGATTTGGG - Intronic
1064795612 10:19008166-19008188 TGTGAGAAATGGTCAGATTCAGG - Intergenic
1064810248 10:19188865-19188887 GGTCAGAAGTGGGCAGATTCTGG + Intronic
1065071627 10:22030989-22031011 GTGGAGAAATGGTCAGATTCTGG - Intergenic
1066380039 10:34893334-34893356 GGTGAGAAATGGTCGGATTCTGG + Intergenic
1067987861 10:51171059-51171081 GGTAAGAAATGGTCAAATTTAGG + Intronic
1068844296 10:61654464-61654486 GGGAAAAATTGGGCAGATTGAGG - Intergenic
1069302090 10:66920883-66920905 GGTGAGCATTGGTTAGATTCGGG - Intronic
1070333936 10:75438124-75438146 GACTAAAATTGGCCAGATTCAGG - Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1070981137 10:80649040-80649062 GGCAGGGATTGGTCAGAATCTGG - Intergenic
1071364182 10:84882295-84882317 GGCAGGAATTGGTGCGTTTCTGG - Intergenic
1071714370 10:88080378-88080400 TAAAAGAAGTGGTCAGATTCGGG - Intergenic
1074065568 10:110009235-110009257 GGAAGGAATTGATAAGATTCTGG + Intronic
1078366456 11:10710641-10710663 GGTAAGAAATGGTCAGATTCTGG - Intergenic
1078643080 11:13114163-13114185 AGCCAGAATTGGGCAGCTTCTGG + Intergenic
1079100777 11:17540737-17540759 GGTGAGAATGGGTCGGATTCAGG - Intronic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1079686553 11:23366012-23366034 GGCAATATTTGCTCAAATTCTGG + Intergenic
1079893539 11:26089853-26089875 GGCAAGAAACGGTCAAAATCTGG - Intergenic
1080632391 11:34090268-34090290 GGAACCAATTGATCAGATTCAGG + Exonic
1082726868 11:56746824-56746846 GGGGAGAAGTGGTCAGATTCAGG - Intergenic
1083026644 11:59556799-59556821 GGCAAGAATTGTGCAGCTTTTGG + Intergenic
1083790387 11:64980978-64981000 GAAAAGAAGTGGTCGGATTCAGG - Intergenic
1084005190 11:66318885-66318907 GTCCAGGAGTGGTCAGATTCTGG - Intergenic
1085547703 11:77335535-77335557 AGTGAGAAGTGGTCAGATTCAGG - Intronic
1087708207 11:101519723-101519745 AGCAAGAGGTGTTCAGATTCTGG - Intronic
1088866295 11:113851172-113851194 GACAAGCATGGGTCAGATTAGGG - Intronic
1089059254 11:115612803-115612825 GGAGAGAATGGATCAGATTCTGG - Intergenic
1089880609 11:121769816-121769838 GGTGAGAAGGGGTCAGATTCTGG - Intergenic
1090616120 11:128516916-128516938 GGGAAGAAATGGGCAGAATCTGG + Intronic
1090742149 11:129674091-129674113 GACAAGAAGTGGTAGGATTCGGG + Intergenic
1091002560 11:131922597-131922619 GGTAAAAAGTGGTCTGATTCAGG - Intronic
1092267733 12:6995812-6995834 GGAGAGAAGTGGTCAGATTTTGG - Intronic
1092278063 12:7077249-7077271 GGTGAGAAGTGGTCAGATTATGG - Intergenic
1093608639 12:21126692-21126714 GGTAAGAAATCATCAGATTCTGG + Intronic
1093682368 12:22017190-22017212 AGTGAGAAGTGGTCAGATTCTGG + Intergenic
1094009553 12:25792836-25792858 GGAGAGAAGTGGGCAGATTCAGG + Intergenic
1094068707 12:26389036-26389058 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1094080455 12:26529006-26529028 GGCAAGAAGTTGTAGGATTCTGG - Intronic
1094626906 12:32132925-32132947 GGTAAGAAGTGATCTGATTCAGG + Intronic
1094762097 12:33545792-33545814 GGTAAGAAATGATCAGAGTCTGG - Intergenic
1095528434 12:43155985-43156007 GGTGAGTAGTGGTCAGATTCTGG - Intergenic
1095675017 12:44906530-44906552 GGTGAGAAGTGGTGAGATTCTGG + Intronic
1096423996 12:51485339-51485361 GGTAAGAAGTGATCAGACTCGGG + Intronic
1096488520 12:52000464-52000486 GGCAACAATAGGGCAGATTTGGG + Intergenic
1096772616 12:53945620-53945642 GGCAAGAATTGGGGCCATTCGGG - Exonic
1097903445 12:64896375-64896397 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1098605967 12:72389947-72389969 GGTAAGAAGGGGGCAGATTCTGG + Intronic
1099205334 12:79720452-79720474 GGCAAGAATTTGTGAGATTTGGG - Intergenic
1099652675 12:85448211-85448233 GAGAAGAAGTGGTTAGATTCTGG + Intergenic
1100139909 12:91604760-91604782 GGCTAGAATTGGTCATTTCCAGG - Intergenic
1100885628 12:99066733-99066755 AGCAAGAAGTAGTTAGATTCTGG + Intronic
1101065103 12:101012813-101012835 GGTGAGAAAGGGTCAGATTCAGG + Intronic
1102220184 12:111188904-111188926 AGCAAGATGTGGGCAGATTCAGG + Intronic
1102510860 12:113414515-113414537 GGTGAGAAGTGGTCACATTCTGG - Intronic
1103176829 12:118871637-118871659 GGTGAGAACCGGTCAGATTCTGG - Intergenic
1104126609 12:125852851-125852873 CACCAGAATTGATCAGATTCCGG - Intergenic
1105797199 13:23866966-23866988 GGTAAGATGTGATCAGATTCTGG - Intronic
1105958241 13:25304295-25304317 GGCAATAATTGGTCAAGTTTAGG + Intronic
1106006645 13:25776309-25776331 AGGAAGAATGGGTCAGTTTCAGG - Intronic
1107313271 13:39103543-39103565 GATAAGAAATGGCCAGATTCTGG - Intergenic
1107696250 13:43002968-43002990 GGTGAGAAGTGGTGAGATTCTGG + Intergenic
1108071951 13:46637210-46637232 GACAAGAAGTGGTCACATTCAGG - Intronic
1108446080 13:50510352-50510374 GGAAAGAAATGGGCAGATTGGGG + Intronic
1108458812 13:50644444-50644466 GGTGAGAAATTGTCAGATTCGGG - Intronic
1108684003 13:52803309-52803331 GGTAAGAAGTGATTAGATTCTGG + Intergenic
1108782980 13:53859058-53859080 AGCAAGAATTGGGTAGTTTCAGG + Intergenic
1109513039 13:63404404-63404426 GGCTAGAACTGCTGAGATTCAGG + Intergenic
1110451905 13:75646257-75646279 GGCAAGAGGTGGTCAGATTCTGG - Intronic
1112149310 13:96739629-96739651 GGTGAGAAATGGTCCGATTCTGG - Intronic
1112199409 13:97260560-97260582 GGTGAGAAGTGGTCAGACTCTGG + Intronic
1112588696 13:100743993-100744015 AAGAAGAATTGGACAGATTCGGG + Intergenic
1113493173 13:110708003-110708025 GGCAAGAAGTGATAATATTCAGG - Intronic
1116007353 14:39309102-39309124 GGTAAAAAGTGGTCAGATTCAGG - Intronic
1116877205 14:50123858-50123880 GGCAAAAAATTGTTAGATTCTGG + Intronic
1117847883 14:59932683-59932705 GGTAAGAAGTGATCAGACTCTGG - Intronic
1118575042 14:67233711-67233733 GGGGAGAAGTGGTTAGATTCTGG + Intergenic
1118891806 14:69916288-69916310 GGCAAGAAGCGGGTAGATTCTGG - Intronic
1119274168 14:73338389-73338411 GGTAAGACAGGGTCAGATTCTGG - Intronic
1119355461 14:74002614-74002636 GGTCAGAAATGGTCGGATTCTGG - Intronic
1120237191 14:81905351-81905373 GGCCACATTTGGTCAGATTCTGG + Intergenic
1122849527 14:104520022-104520044 GGCCAGATTAGGTTAGATTCAGG + Intronic
1124068737 15:26371305-26371327 GGCAGGAAGTGGTTGGATTCTGG - Intergenic
1124893379 15:33754158-33754180 GGTGAGAAGTGGTCAAATTCTGG - Intronic
1126772299 15:52070505-52070527 GGTGAAAAGTGGTCAGATTCTGG - Intergenic
1127912972 15:63433530-63433552 GGCGAGAAAGGGTCAGGTTCTGG - Intergenic
1128105716 15:65043250-65043272 GATGAGAAGTGGTCAGATTCAGG - Intergenic
1128823417 15:70684310-70684332 TGCAAGAATTGGTGACAATCTGG - Exonic
1130346221 15:83048087-83048109 GTTAAGTAGTGGTCAGATTCAGG + Intronic
1130446721 15:84008981-84009003 GGTAAGAGACGGTCAGATTCTGG - Intronic
1130948057 15:88564017-88564039 GGTGAGAAATGGTCAGATTTGGG + Intergenic
1132206479 15:99989314-99989336 GGCAAGAAGTGGTCAGTTCTAGG - Intronic
1132370463 15:101294441-101294463 AGCAAGACTTGGTAAGATACTGG - Intronic
1134104717 16:11477363-11477385 TGCAATATTTGGTCCGATTCTGG - Intronic
1138567639 16:57845257-57845279 GGTGAGAAGTGGACAGATTCTGG - Intronic
1138620969 16:58211077-58211099 GGTGAGAAATGCTCAGATTCGGG + Intergenic
1139294464 16:65888131-65888153 GAAAAGAAATGGTCACATTCAGG + Intergenic
1139711668 16:68780987-68781009 GGCCAGAATTGGGAAGATTAAGG + Intronic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1140677339 16:77345456-77345478 GGCCATAATTGTTCAGATTCTGG - Intronic
1141241649 16:82270621-82270643 GGCAATAATTGATCAAATCCTGG - Intergenic
1141784251 16:86187990-86188012 TGCAAGAATGGCTCAGAGTCAGG + Intergenic
1142850961 17:2704573-2704595 GACAAGAACGGGTCAGAATCAGG + Intronic
1143094207 17:4468413-4468435 GTGGAGAAGTGGTCAGATTCTGG + Intronic
1143640350 17:8192833-8192855 GATGAGAAGTGGTCAGATTCTGG - Intergenic
1143698509 17:8638961-8638983 GGAAAGATATGGTCAGATTGCGG + Intergenic
1145883279 17:28366897-28366919 GGCAAGAGTTGGTGGGGTTCTGG - Intronic
1146210360 17:30937663-30937685 GGTTAGAAGTGGTCAGATTCTGG + Intronic
1146927412 17:36754509-36754531 GGAGAGCAGTGGTCAGATTCCGG + Intergenic
1147047752 17:37767387-37767409 GCCAAGAAGTGGTCAGATCCTGG - Intergenic
1147048595 17:37773454-37773476 TGGAAGAATTGGGCAAATTCTGG + Intergenic
1149458231 17:56806886-56806908 GGCGAGAAGTAGTCAGGTTCTGG + Intronic
1149673062 17:58432868-58432890 GGTGAGAAATGGTCAGATTCTGG + Intronic
1150008197 17:61482702-61482724 ACCAAGAAGTGGTCAGATTACGG - Intronic
1152107396 17:78338727-78338749 GGGAAGACTGGGTCAGATCCTGG - Intergenic
1154226100 18:12505591-12505613 GGAGAGAAGTGGTCAGAATCAGG + Intronic
1155281702 18:24246874-24246896 GATGAGAAGTGGTCAGATTCTGG + Intronic
1155832466 18:30535009-30535031 GGCAAAAATTGGGAAGATTTGGG + Intergenic
1155870884 18:31026569-31026591 GGTGAGAAGTGGTTAGATTCTGG + Intronic
1158157126 18:54438624-54438646 AGCAAGAACTGGTCAAATTCAGG - Intergenic
1158433611 18:57416463-57416485 GGTGAGAATTGGTCAGACTTGGG - Intergenic
1159683602 18:71387458-71387480 AGCTAGAAATGGTCAAATTCAGG + Intergenic
1159755447 18:72358433-72358455 GGCAGGAATTGGTGAGTGTCTGG - Intergenic
1165098184 19:33421824-33421846 GCGGAGAAGTGGTCAGATTCTGG - Intronic
1165223717 19:34338987-34339009 GGCGAGAAGTGCTTAGATTCTGG + Intronic
1166386262 19:42383270-42383292 GGAGAGAAGTGGTGAGATTCTGG + Intergenic
1167026720 19:46925055-46925077 TGCAAGAAGTGGTCGGCTTCCGG + Intronic
1167555622 19:50193356-50193378 GGCAAGAAGGGGTCGGATTCTGG + Intronic
1167704320 19:51069867-51069889 GGTAAGAAACAGTCAGATTCTGG - Intergenic
1167780420 19:51595247-51595269 GGAGAGAAGTGGTTAGATTCTGG - Intergenic
926918729 2:17918227-17918249 GACTGGAATTGGTCAGAGTCTGG + Intronic
926966824 2:18424045-18424067 GGCAAGAATTGCTCAGATGCAGG + Intergenic
929326039 2:40611841-40611863 AACAAGAATTGGTTACATTCTGG - Intergenic
929461943 2:42108810-42108832 GGCAAGAAGTGGTTGGATTCTGG - Intergenic
929836377 2:45404579-45404601 GGTGAGAAGTGTTCAGATTCTGG - Intronic
930597132 2:53402549-53402571 GGCAAGAAGTGATCAGATTTTGG + Intergenic
930659556 2:54040133-54040155 GGTGAGAATTGGTCAGATTCTGG + Intronic
931553254 2:63470517-63470539 GGTGAGAAATGGCCAGATTCTGG - Intronic
931842446 2:66168616-66168638 GGTAAGAAGTGGCCAGATTTTGG + Intergenic
933349415 2:81135122-81135144 GGAGAGAAATGGACAGATTCTGG + Intergenic
934920033 2:98335610-98335632 GGCAAGAAGTGATGAGAGTCTGG + Intronic
935951706 2:108335634-108335656 TGCGAGGATTGGTCAGATTCTGG + Intergenic
938565833 2:132517735-132517757 TGAAAGAATTGGTAAAATTCAGG + Intronic
939839458 2:147169526-147169548 GGTAAGAAATTGTCAGATACTGG - Intergenic
940201913 2:151161280-151161302 GAAATGAATTTGTCAGATTCAGG - Intergenic
941238605 2:163008874-163008896 TGCAAGAATTTTTCAGTTTCAGG - Intergenic
941809019 2:169737425-169737447 GGCAAGTAGTGGTGAGACTCAGG - Intronic
942489424 2:176474848-176474870 GGCAAGAAGTGGGCAGATTCTGG + Intergenic
942537394 2:176979350-176979372 GGGAAGAATTGGTAAAATTTCGG - Intergenic
942619132 2:177829028-177829050 GGTAAGAAGTGGTCAGATTCTGG + Intronic
942698832 2:178679819-178679841 GGTCTGATTTGGTCAGATTCTGG - Intronic
943058539 2:183013508-183013530 GGTGAGAAATGTTCAGATTCTGG - Intronic
943679850 2:190756808-190756830 TGCAAAAATTGGTCTGATCCTGG - Intergenic
945122298 2:206469420-206469442 GATGAGACTTGGTCAGATTCTGG - Intronic
948100368 2:235368030-235368052 GGTGAGAATCGGTCAGATCCTGG - Intergenic
1170487420 20:16832906-16832928 GGAGAGAAGAGGTCAGATTCTGG - Intergenic
1170976884 20:21173242-21173264 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1172108897 20:32533903-32533925 GGCAAGATTCAGTCCGATTCAGG - Intronic
1172121611 20:32602177-32602199 GGTGAGATGTGGTCAGATTCCGG - Intronic
1173222864 20:41143687-41143709 GGCTAGAGCTGGTCAGATTTGGG + Intronic
1173849594 20:46209644-46209666 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1176261585 20:64184684-64184706 GGTCAGAAATGGTCAGATTCTGG + Intronic
1176888926 21:14290625-14290647 GATAAGAAGTGGTCAGACTCTGG + Intergenic
1177134591 21:17296078-17296100 GGCCAGAAGTGGCCAGATGCAGG + Intergenic
1177992230 21:28051539-28051561 TGCATGAATTTTTCAGATTCCGG + Intergenic
1178570058 21:33727830-33727852 GGAAAGAAGTGGCCAGATTGGGG - Intronic
1179064209 21:38008953-38008975 TGAGAGAAGTGGTCAGATTCTGG + Intronic
1181744345 22:24945419-24945441 GACAAAGAGTGGTCAGATTCTGG + Intronic
1181925445 22:26354983-26355005 GGCGAGAGATGGTCCGATTCTGG + Intronic
1182092298 22:27604084-27604106 GGCAGGAGTTGGGCAGCTTCTGG - Intergenic
1183121257 22:35731841-35731863 GGTGAGAAGTGGTCAGATTTTGG + Intergenic
1184001266 22:41675402-41675424 AAGAAGAAGTGGTCAGATTCAGG - Intronic
949590768 3:5491937-5491959 GGGCTGAAGTGGTCAGATTCTGG - Intergenic
950008759 3:9707460-9707482 GGGGAGAAGTGGTCAGATTCAGG + Intronic
950635582 3:14312070-14312092 GGTGAGAAGTGGTCAGATTTTGG + Intergenic
952258399 3:31715058-31715080 GGGAAGTATGGGTCAGATTGAGG - Intronic
952321539 3:32282500-32282522 GGTAAGAATTGATAACATTCTGG - Intronic
952909910 3:38174686-38174708 GGTGAGAAGTGGTCAGATTCTGG + Intronic
952975115 3:38687279-38687301 GGTAAGAAATGGTCAAATCCTGG + Intergenic
954337140 3:49925840-49925862 GGTGACAAGTGGTCAGATTCTGG - Intronic
954759012 3:52860713-52860735 GGGGAGAAGAGGTCAGATTCCGG + Intronic
955152618 3:56383088-56383110 GGTGAGAAGTGGTCAGATTATGG - Intronic
955295295 3:57729366-57729388 GGGGAGAAAAGGTCAGATTCTGG + Intergenic
955671123 3:61404414-61404436 GGCCAGATTTGATCAGCTTCAGG - Intergenic
955846838 3:63172709-63172731 TGCAAGAATTGCAAAGATTCAGG + Intergenic
956488045 3:69742028-69742050 GGTAAGAAGCGGGCAGATTCTGG - Intronic
956803600 3:72786544-72786566 TGTAAGAATTGGTCAGATGCAGG - Intronic
957151863 3:76496799-76496821 GATGAGAAGTGGTCAGATTCTGG - Intronic
958054907 3:88396897-88396919 GGAAAGAATTGGATATATTCAGG + Intergenic
958193825 3:90217612-90217634 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
958417181 3:93888661-93888683 GGTAAGAAGTGGTCAGATTCTGG - Intronic
959343474 3:105161540-105161562 GGGAAGAAGTGGTCAGGGTCTGG - Intergenic
959401703 3:105910591-105910613 AGCAGAAATTGGTCAGATACAGG + Intergenic
959582310 3:107994005-107994027 GGTGAGAAATGGTCAGACTCTGG - Intergenic
959593440 3:108103653-108103675 AGCAAGAAGGGGTCAGATACTGG + Intergenic
959792207 3:110375461-110375483 GCTAAGAAGTGCTCAGATTCTGG + Intergenic
961114370 3:124316169-124316191 GGCAATAAGAGGCCAGATTCTGG - Intronic
962486183 3:135844887-135844909 GGTAAGAAGTTGTCAGATACTGG + Intergenic
962572695 3:136726966-136726988 GGCAAGAATGGTCCAGATACAGG - Intronic
963410366 3:144920079-144920101 GGAAAGAAATGGACTGATTCTGG - Intergenic
963453226 3:145511634-145511656 GGAAAGAAGTGGTCAGATCCTGG - Intergenic
963619124 3:147582618-147582640 GCCAAAATTTGGTCAGATTTTGG + Intergenic
964099284 3:152969275-152969297 AGTGAGAAGTGGTCAGATTCTGG - Intergenic
964838853 3:160971720-160971742 GGCAAGAATTGGTCTGTATAAGG - Intronic
964863583 3:161229355-161229377 GGTAAGAAGTGGACAGATTTTGG + Intronic
965617301 3:170607796-170607818 GGTAAGAAATGGCCAGATTCTGG + Intronic
965660568 3:171037606-171037628 GGTAAGATGTGGTCAGATTCAGG - Intergenic
967743577 3:193029934-193029956 GGCAGCAATTAGTCAGATTTTGG - Intergenic
967806148 3:193716156-193716178 AGAAAGAATGGGCCAGATTCAGG - Intergenic
969133442 4:5010550-5010572 GCTAAGAATTGGTCACATTCTGG + Intergenic
969355297 4:6621413-6621435 GGCAGGAAATGGTCATATTTGGG + Exonic
971246642 4:24935146-24935168 TGCAAGAATTTATCAGATTCTGG + Intronic
971282300 4:25250829-25250851 GGCAAGAGGTGGTTGGATTCTGG + Intronic
971489392 4:27195119-27195141 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
972745915 4:41932718-41932740 GGAAAGAAGTGATGAGATTCTGG - Intergenic
972906372 4:43752811-43752833 GTTGAGAACTGGTCAGATTCTGG - Intergenic
973789911 4:54368257-54368279 TGTAAGAAGTGATCAGATTCAGG + Intergenic
973830915 4:54757877-54757899 GGTAAGAAATGGTTAGATTCAGG + Intergenic
974133611 4:57787477-57787499 GGTAAGAAGTGGTCAGATTTGGG + Intergenic
974245591 4:59312336-59312358 GGAGAGAATTGGTCAGAATCAGG - Intergenic
974285830 4:59865970-59865992 AGCAAGAATTGTTTTGATTCTGG + Intergenic
974356175 4:60815640-60815662 GGTAAGAAGTGGTTAGATTCTGG - Intergenic
975515925 4:75248192-75248214 GGCAAAAGTTGGTCATTTTCTGG - Intergenic
976208216 4:82641779-82641801 GGTGAGAAATGGTCAGAATCTGG + Intronic
976434158 4:84997756-84997778 GGCAAGCATTGTTTGGATTCAGG - Intergenic
976913464 4:90339247-90339269 GGTGAGAACTGGTCAAATTCTGG - Intronic
977035957 4:91953863-91953885 GTCAAGTGTTGGTCAGATTGTGG - Intergenic
977529457 4:98183064-98183086 GAGGAGAAGTGGTCAGATTCTGG - Intergenic
977617629 4:99104028-99104050 CGCAAGAGTTGGTCAGAGTTTGG - Intergenic
977715861 4:100183201-100183223 GGCCAGTATTTGTCACATTCTGG + Intergenic
978451657 4:108840530-108840552 GGCAGGTATTGGTCTGACTCAGG - Intronic
978467767 4:109027688-109027710 GGTAAAAAGTGGTCAGTTTCTGG + Intronic
978986151 4:115015308-115015330 GGCAAGACCTGGTAAAATTCAGG + Intronic
979304457 4:119126534-119126556 GGTGAGATGTGGTCAGATTCTGG - Intergenic
979557975 4:122072621-122072643 TGTAAAAACTGGTCAGATTCTGG + Intergenic
980170706 4:129286257-129286279 AGCTAGAATTGCTCAGATTTGGG - Intergenic
980700532 4:136423061-136423083 GGCAAGAAGTGGTCAGATATTGG + Intergenic
980974668 4:139599148-139599170 GGTAAGATGTGGGCAGATTCTGG - Intronic
981225542 4:142289924-142289946 GGTAAGACATGGTCACATTCTGG - Intronic
981708207 4:147683458-147683480 GGTGAGAACTGGTAAGATTCTGG + Intronic
981831015 4:149001938-149001960 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
983224420 4:165072647-165072669 GCCAAGAATTGGTTGGACTCTGG + Intergenic
983918311 4:173315940-173315962 GGCAACAAGGGATCAGATTCTGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985053662 4:186017550-186017572 GGCATGAATAGGTCAGTTTTGGG + Intergenic
987236806 5:15950770-15950792 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
987573596 5:19698158-19698180 TACAAGAATAGGTCACATTCTGG + Intronic
988022985 5:25647770-25647792 GGCTAGGAATGGTGAGATTCTGG - Intergenic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
988943926 5:36175128-36175150 GGTAAGAAATGATCAGATTTGGG + Intronic
990781553 5:59370067-59370089 GGCGAGAAGTGATCAGATTCTGG - Intronic
990900843 5:60747263-60747285 GCCCAGGATTGGTCAGATTCTGG + Intergenic
992091064 5:73317405-73317427 GGCAAGAACTTTTCAGGTTCTGG + Intergenic
992367354 5:76106249-76106271 GGCAAGAAGTGGTTACATTCTGG - Intronic
992685532 5:79195757-79195779 TGCAAAATTTGGTCAGATTGAGG - Intronic
993030756 5:82703254-82703276 GGTGAGAAATGGTCACATTCTGG + Intergenic
993160782 5:84288259-84288281 GGTGAGAAATGGTCACATTCTGG - Intronic
993736354 5:91480868-91480890 AGTAAGAAGTGGTCAGGTTCTGG - Intergenic
995197257 5:109385324-109385346 GGTAAGAAATGACCAGATTCTGG + Intronic
996186134 5:120477483-120477505 GGTAAAAATTGGTCAGACTTTGG - Intronic
996570189 5:124925192-124925214 GTTAAGAAGTAGTCAGATTCTGG + Intergenic
997872539 5:137517800-137517822 GGTAAGAATTGATGGGATTCTGG + Intronic
998225923 5:140326183-140326205 GGTGGGAAATGGTCAGATTCGGG - Intergenic
998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG + Intergenic
1000100290 5:158009740-158009762 GGTGAGAAGTAGTCAGATTCTGG - Intergenic
1000371049 5:160537055-160537077 GGCAAGAAGTGATCAGATTCAGG - Intergenic
1000437671 5:161232961-161232983 GAAGAGAATTGGTCAGAATCTGG - Intergenic
1000442734 5:161282531-161282553 AGTGAGAAGTGGTCAGATTCTGG + Intergenic
1000475994 5:161707957-161707979 GGCAAGAGTTGGGAAGATTCTGG - Intergenic
1001747538 5:174103241-174103263 GGTAAAAAGTGGTCAGATTATGG + Intronic
1002111882 5:176921271-176921293 AGCAAGAAGCGTTCAGATTCAGG - Intronic
1002537431 5:179885003-179885025 TGTAAGAAGGGGTCAGATTCAGG - Intronic
1003398479 6:5772720-5772742 GACAAATATTGCTCAGATTCTGG - Intergenic
1003851336 6:10225787-10225809 GAAAAGAAATGGTCAGATTCTGG + Intergenic
1005128954 6:22480821-22480843 GGCAAGAATTTCTCAGAGTGAGG + Intergenic
1007381275 6:41491751-41491773 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1008702181 6:54114537-54114559 GGTAAGAACTGTTAAGATTCTGG - Intronic
1009891308 6:69686678-69686700 GGCAAAAAGTGGTCAGGATCTGG - Intronic
1011175111 6:84551614-84551636 GATGAGAAGTGGTCAGATTCTGG - Intergenic
1011440433 6:87381203-87381225 GGTGAGCAGTGGTCAGATTCTGG + Intronic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1011587592 6:88943424-88943446 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1011598628 6:89039897-89039919 GGCAAGAAGTGGTGAAATTCAGG - Intergenic
1011795251 6:90945989-90946011 GGCTAGAATTGGTCAGTGTCTGG + Intergenic
1012605155 6:101149049-101149071 GGGAAGCATTGATTAGATTCAGG + Intergenic
1012638614 6:101580433-101580455 GGTGAAAAATGGTCAGATTCTGG - Intronic
1012997072 6:105984769-105984791 CGTAAGCAATGGTCAGATTCTGG + Intergenic
1013089813 6:106890116-106890138 CCCCAGAATTGGTTAGATTCAGG - Intergenic
1013091470 6:106904548-106904570 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1013186087 6:107759494-107759516 GGAAAGAATTGATTGGATTCAGG + Intronic
1013581848 6:111542812-111542834 GGAAAGTAGTGGTCAGATTCTGG + Intergenic
1014429432 6:121349797-121349819 GATAAGAAATGGACAGATTCTGG - Intergenic
1014586763 6:123207420-123207442 GTCAAGAATTGGGCAGTTTGGGG - Intergenic
1015413207 6:132917998-132918020 GAAAAGAAGTGGACAGATTCTGG - Intergenic
1016844521 6:148557873-148557895 GGTGAGGAATGGTCAGATTCTGG - Intergenic
1017321029 6:153093528-153093550 GGCAAGAAATGATCATAATCAGG - Intronic
1017337653 6:153281176-153281198 GGGAACAATTGAACAGATTCAGG + Intergenic
1017794392 6:157830059-157830081 GGCAATAATTGATCATATTGGGG - Intronic
1019091909 6:169544248-169544270 GGCAAGAGTAGGACAGATTTGGG + Intronic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1020360111 7:7319080-7319102 GGTGAGAGGTGGTCAGATTCTGG + Intergenic
1020626147 7:10581798-10581820 GGTGAGAAGTGGTCAGATTATGG + Intergenic
1021228990 7:18062670-18062692 GGAGAGATGTGGTCAGATTCTGG + Intergenic
1022412752 7:30151968-30151990 GGCAAGAATTGGACTTTTTCTGG - Intronic
1023791533 7:43757540-43757562 GGTAAGAAGTGGTCAGGCTCTGG + Intergenic
1024582513 7:50811378-50811400 GGCAAGAATTAGAGAGATTGGGG - Intergenic
1026111305 7:67460820-67460842 GGCCACAACTGGTCAGTTTCAGG - Intergenic
1026501171 7:70944586-70944608 GAGGAGAAGTGGTCAGATTCAGG - Intergenic
1028970492 7:96853332-96853354 GGTGAGGATTGATCAGATTCTGG - Intergenic
1029908520 7:104118899-104118921 GGTGAGAAGTTGTCAGATTCTGG - Intergenic
1030327005 7:108230276-108230298 GGTAAGAAATGGTAAGATTCTGG - Intronic
1030857915 7:114584663-114584685 GGCAAGAAGTGAACATATTCAGG - Intronic
1031562405 7:123254517-123254539 GGTGAAAAGTGGTCAGATTCTGG - Intergenic
1031624800 7:123980058-123980080 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1032632782 7:133671699-133671721 GGGGAGAAGTGGTCACATTCTGG + Intronic
1034075317 7:148225748-148225770 GGCGACAAGTGGTAAGATTCAGG + Intronic
1034756710 7:153628574-153628596 TGCAAGAATGGGACAGATGCTGG - Intergenic
1037274792 8:17166245-17166267 GGTGAGAGGTGGTCAGATTCTGG + Intronic
1037363212 8:18095778-18095800 GGTGAGAAGTGGTCAGATTCGGG - Intergenic
1037451567 8:19020707-19020729 GGTAAGAAATGTTGAGATTCTGG + Intronic
1039706262 8:40010611-40010633 GTTGAGAAATGGTCAGATTCTGG + Intronic
1041157091 8:54998801-54998823 GGCTAGAGTTGTTCAGATTTAGG - Intergenic
1042621160 8:70705901-70705923 GGTAAGAAGTGTTTAGATTCTGG + Intronic
1044211842 8:89559989-89560011 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1045159846 8:99526489-99526511 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1045504381 8:102768326-102768348 TGTAAGGATTGGCCAGATTCAGG - Intergenic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1045844822 8:106622199-106622221 GGTAAGGACTGGACAGATTCTGG - Intronic
1045954169 8:107887681-107887703 GGAAAGAAGTGGTTGGATTCAGG - Intergenic
1046091979 8:109513803-109513825 GGTGAGAAGTGGGCAGATTCTGG - Intronic
1048045237 8:130766799-130766821 GGCAAAAAGTGGTCAGACTCAGG - Intergenic
1048231924 8:132650986-132651008 GGCAAGAATTGTTCATATTTGGG - Intronic
1048903529 8:139064012-139064034 AGTAAGACGTGGTCAGATTCTGG + Intergenic
1049217974 8:141416486-141416508 GGCAAGAATGGGTCAGCTTCAGG - Intronic
1050291913 9:4164189-4164211 AGCAAGGATTTGTCAGAGTCAGG - Intronic
1050426581 9:5517739-5517761 GGTGAGAAATGGTCAGATTCTGG + Intronic
1052369243 9:27645573-27645595 GGGAAGGATGGGTCAGAGTCAGG - Intergenic
1053021806 9:34700380-34700402 GGTGAGAAGTGCTCAGATTCTGG + Intergenic
1053402744 9:37841132-37841154 AGCAAGAATTAGCCAGATCCAGG + Intronic
1055912630 9:81369748-81369770 AGCATGAATTGGTCAGTTTGTGG + Intergenic
1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG + Intergenic
1057457739 9:95229417-95229439 GGTAGGAAGTGGTCAGATTCTGG + Intronic
1057709949 9:97430965-97430987 TGCAAGAATTGCTCAGCTTGTGG + Exonic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1060388706 9:123259135-123259157 GATGAGAAGTGGTCAGATTCTGG + Intronic
1060429232 9:123535082-123535104 GGTGAGAAGTGGTCAGATTTGGG - Intronic
1061069880 9:128302796-128302818 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1186332266 X:8547303-8547325 GTCAAGTATTGGTGAGATTGAGG - Intronic
1187328280 X:18312239-18312261 GGCAAGAAGTGGTTGGATTTTGG + Intronic
1187498156 X:19814212-19814234 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1187504462 X:19867555-19867577 AGCAAGAATTTGTCAGCTCCAGG + Intronic
1187711060 X:22054871-22054893 GGTAAGAAGTTGTCAGATTAGGG + Intronic
1187967593 X:24627781-24627803 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1188352230 X:29145865-29145887 GGTGAGAAGTGGTCAGATTTTGG - Intronic
1188951125 X:36376518-36376540 GGGAAGAAATGCTCAGCTTCTGG - Intronic
1189018733 X:37312173-37312195 GGTGAGAAGTGGTCAGATTGTGG - Intergenic
1189186318 X:39058440-39058462 GGTCAGAAGTGGTCAGATTTGGG + Intergenic
1190529614 X:51361688-51361710 AGGAAGGATGGGTCAGATTCAGG - Intergenic
1191999205 X:67130065-67130087 GGTGAGAAGTGGTCAGATTTGGG - Intergenic
1192556767 X:72096230-72096252 GGTAAGAAATGGCCAGATTCTGG + Intergenic
1192784043 X:74320850-74320872 AGCGAGAATTGGGCAGCTTCTGG - Intergenic
1192804568 X:74497421-74497443 AGCGAGAATTGGGCAGCTTCTGG + Intronic
1193821775 X:86173908-86173930 GATAACAATTGGTCAGAGTCTGG + Intronic
1194461530 X:94175586-94175608 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1195374092 X:104209328-104209350 GGTAAGAAATAGTCAGATTCTGG - Intergenic
1196311230 X:114168228-114168250 GGCAAAATGTGGTTAGATTCAGG + Intergenic
1197144652 X:123158257-123158279 AGCCATAATTGGTAAGATTCTGG + Intergenic
1197214748 X:123857628-123857650 GTCGAGAATTGGTGATATTCTGG + Intergenic
1197287053 X:124607866-124607888 GGTGAGAAATGGTCAGATTCTGG + Intronic
1198265227 X:135002687-135002709 GCCAGGAAGTGGTCAGATTCTGG + Intergenic
1198651875 X:138872099-138872121 GGGAAGAAGTAGTTAGATTCTGG + Intronic