ID: 918357892

View in Genome Browser
Species Human (GRCh38)
Location 1:183723505-183723527
Sequence AGGGAGAGTACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 20, 2: 107, 3: 191, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918357886_918357892 10 Left 918357886 1:183723472-183723494 CCGCATAGCAAAGAGAATCTGTG 0: 1
1: 2
2: 3
3: 27
4: 230
Right 918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG 0: 1
1: 20
2: 107
3: 191
4: 439
918357884_918357892 22 Left 918357884 1:183723460-183723482 CCCTGGCAGTGGCCGCATAGCAA 0: 1
1: 0
2: 1
3: 26
4: 93
Right 918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG 0: 1
1: 20
2: 107
3: 191
4: 439
918357885_918357892 21 Left 918357885 1:183723461-183723483 CCTGGCAGTGGCCGCATAGCAAA 0: 1
1: 0
2: 0
3: 17
4: 100
Right 918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG 0: 1
1: 20
2: 107
3: 191
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918357892 Original CRISPR AGGGAGAGTACAGTGACTGT GGG Intronic
900537929 1:3187953-3187975 AGGCAGAGGACAGTGTGTGTGGG + Intronic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
904108648 1:28107409-28107431 AGGTAGAGAACAGGGCCTGTAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907525644 1:55052524-55052546 AGGGAGGGGACAGTGACAGCTGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909637240 1:77830035-77830057 AGGGTGAGTCCATTCACTGTGGG + Intronic
909663707 1:78111089-78111111 ATGGAAAGTACAGAAACTGTTGG + Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911046297 1:93631509-93631531 TGGCAGAGGACAGTGACTATTGG + Intronic
911678920 1:100691832-100691854 TGGGTGAGGCCAGTGACTGTTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912392645 1:109315121-109315143 AGGGAGACTACTGTAACAGTAGG + Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915979765 1:160412765-160412787 AGGGAAACTATAATGACTGTAGG - Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920071132 1:203304180-203304202 AGGGAGAGGACAGAGCCGGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922596834 1:226820363-226820385 CGGGAGAGAAGAGTGGCTGTGGG + Intergenic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066194728 10:33088175-33088197 AGGTAGAATAGAGTGACTCTAGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067406061 10:46024420-46024442 AGAGAGAGAACAGAGACCGTTGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070780104 10:79132722-79132744 GGGGAGAGAACACTGGCTGTGGG - Intronic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076363468 10:129906545-129906567 AGGGAGAGGACAGTCCCTATGGG + Intronic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079026222 11:16950060-16950082 AGGCAGAGTAAAGTGTGTGTGGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080113085 11:28591717-28591739 AGAGAATGTACAGTGAGTGTAGG - Intergenic
1080938394 11:36886064-36886086 AGGGAGAGTCCAGTGGCAGCAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086928179 11:92663422-92663444 AGGGAGAGTATAGTTGCTGATGG + Intronic
1087029126 11:93684715-93684737 AGGGAGAGTCCAGTGGCAGCAGG - Intronic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088177589 11:107071868-107071890 AGGGTGTGTATAGTGACTGTTGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089682859 11:120129159-120129181 AGGAAGAGGACACAGACTGTTGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090635130 11:128686359-128686381 GGGGAGAGTAAAAGGACTGTAGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1093699031 12:22196915-22196937 TGGGAGAGGACAGAGACTGACGG + Exonic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096396597 12:51270526-51270548 ATGGAGAGTAAAGTGACAATCGG - Exonic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1097981351 12:65741032-65741054 AGGGAGAGGACTGGGAATGTTGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1103943505 12:124513470-124513492 AGGGATAGTAGAGGGACTTTTGG + Intronic
1104572345 12:129935968-129935990 AGGGAGAGTACACTGAGTCCGGG + Intergenic
1104997657 12:132668624-132668646 GGGGCGAGTTCAGTGAGTGTCGG - Exonic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106824568 13:33506043-33506065 CTGAAGAGTACAGTGACTATGGG - Intergenic
1107060388 13:36154011-36154033 AGGCAGCTTACAGTCACTGTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110329706 13:74257364-74257386 CTGGAGAGTACAGGGACTCTCGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110542274 13:76719959-76719981 AGGGATAGTACAGTGGCAGCAGG + Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113079537 13:106503703-106503725 AGAGAGAGTCCAGTGGCAGTGGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114558834 14:23577325-23577347 AGGGCGAGTACAGCGGCTGCTGG - Exonic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115181106 14:30626665-30626687 TAGGAGAGTCCAGTGACAGTGGG - Intronic
1115485964 14:33911592-33911614 AGAGAGAGTCCAGTGGCAGTGGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118672412 14:68143702-68143724 AGGCAGAGTATAGTGACAGCTGG - Intronic
1118806308 14:69240155-69240177 AGGGAGAGGAGAGTGTGTGTGGG + Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1120894401 14:89516908-89516930 AGGCTAAGAACAGTGACTGTTGG - Intronic
1124032464 15:26023955-26023977 AGGGACAGTCCAGTGGCAGTGGG + Intergenic
1124867305 15:33505038-33505060 CTGGAGAGTACACTGTCTGTGGG + Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127966346 15:63925455-63925477 AGGGTGAGTCCCGTGGCTGTGGG - Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128248898 15:66151401-66151423 AGGGAGAGAACCCTGAGTGTGGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129824230 15:78624299-78624321 AGGCAGGGTAACGTGACTGTAGG + Exonic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1142235857 16:88922223-88922245 AGGGTGAGAACAGTTTCTGTGGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145296669 17:21598407-21598429 AGTGAGGGGACAGTGGCTGTTGG - Intergenic
1145367110 17:22273671-22273693 AGTGAGGGGACAGTGGCTGTTGG + Intergenic
1145943624 17:28757677-28757699 AGGGCAAGTGCAGTGGCTGTGGG + Exonic
1145995911 17:29104877-29104899 AGGGATAGTAAAGTGCCAGTTGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146260537 17:31417418-31417440 GGGGAAAGGACAGTGCCTGTGGG - Intronic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1148159080 17:45439879-45439901 GGGGAGGGTACAGTGAATTTGGG - Intronic
1148767643 17:50048477-50048499 AGGGACAGTCCAGTGGCAGTGGG + Intergenic
1148813708 17:50311773-50311795 AGTGATATTAAAGTGACTGTTGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1166211091 19:41306880-41306902 AGTGAGGCTACAGTGACTGAGGG + Exonic
1168275698 19:55277167-55277189 AGGCAGAGTAGAGTGAGTGAGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930593094 2:53353548-53353570 AGGGTGAGTCCTGTGACTGCTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931151173 2:59575114-59575136 AGGGAGACTAGTGTGACTGGAGG + Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931445146 2:62320935-62320957 AGGGACAGTCCAGTGGCAGTGGG - Intergenic
931773839 2:65523045-65523067 AGGGAGCGTACAGTAAGTATGGG - Intergenic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
937296054 2:120810522-120810544 AGGGAGAGGAGAGAGGCTGTTGG - Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938722916 2:134082249-134082271 AGGCACAGTACAGGGACTTTTGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939736850 2:145857773-145857795 TGAGAGAGTAGAGTCACTGTTGG - Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940320229 2:152369076-152369098 AGGGAGAGTAGTCTGAGTGTAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940905036 2:159161234-159161256 AGGGAGAGCACTTTGACTTTTGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169294332 20:4380225-4380247 AGGTATAGTACAGTGTCTCTTGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171415698 20:24979226-24979248 AGGTAGACTCCAGTGGCTGTAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172952346 20:38730198-38730220 AGGGCCAGTCCAGGGACTGTTGG + Intergenic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1173895495 20:46547654-46547676 AGGGAGAGTTCGGTGGCTTTTGG + Intronic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181519169 22:23435481-23435503 AGGGAGTGTGCAGTGACATTGGG + Intergenic
1184385426 22:44171588-44171610 GGGGAGAGGACGGTTACTGTGGG + Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1184599085 22:45532152-45532174 AGTCAGTGTACAGTGACAGTTGG + Intronic
949315625 3:2751477-2751499 AGGGAGTGTAGAGTGAATGAAGG - Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
952862280 3:37823054-37823076 AGGGAGAATACAGAGCCAGTAGG + Exonic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956588466 3:70888586-70888608 GGGGAGAGTCCAGTGGCAGTGGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961426944 3:126855867-126855889 AGGGACAGTCCAGTGGCAGTGGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964476274 3:157100464-157100486 TGGGGGACTACAGTGGCTGTGGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966539802 3:181076645-181076667 AGGAAGAGAACTGTGTCTGTAGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968577779 4:1375967-1375989 AGGGAGAGGAGGGTGGCTGTGGG + Intronic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970301059 4:14681609-14681631 AGTGAGAGTCCTGAGACTGTGGG - Intergenic
970336049 4:15044005-15044027 AGGGAGTGTACAGTTACCCTGGG - Intronic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975837725 4:78442065-78442087 ATGGAGAGTCCATTGACTGCAGG + Intronic
976266778 4:83192586-83192608 AGGGAGAGAACAGGGGCTGAAGG + Intergenic
976454446 4:85229355-85229377 GGGGTGAGTAAAGGGACTGTAGG - Intergenic
976684166 4:87792512-87792534 AGGTACATTACAGTGAGTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977839509 4:101685274-101685296 AGGGATAGTACAGTGCCGGCTGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986091491 5:4512561-4512583 AGCGACAGGACAGAGACTGTAGG - Intergenic
986424248 5:7614604-7614626 AGGGTGAGAAGAGTGACTATGGG - Intronic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993535084 5:89074235-89074257 AGATAAAGTACAGTGACTGGAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994226050 5:97253171-97253193 AGGGAAAGTACAATTACTGGGGG + Intergenic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997267736 5:132505915-132505937 AGGGAGAGAAAACTGTCTGTTGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998529519 5:142871847-142871869 AGGGAGAGATCGGAGACTGTTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001141059 5:169144371-169144393 AGGAAAAGTACAGAGACTATGGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1003485543 6:6574057-6574079 AGCCAGAGTAAAGAGACTGTAGG + Intergenic
1004288892 6:14348696-14348718 AGGGACAGTAGGGTGACAGTAGG + Intergenic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012145769 6:95679764-95679786 ATGCAGACTACAGTGACTCTAGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016214926 6:141588088-141588110 TGAGTGAGTACAGGGACTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016366599 6:143325309-143325331 AGGAAGAGTACAGGGTCTGAAGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018696311 6:166394204-166394226 TGGGAAAGTACAGTATCTGTGGG + Intergenic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1019592112 7:1840845-1840867 AGGGAGTGTGCAGTGACATTGGG - Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020470722 7:8531507-8531529 ATAGAGAGTACAGTAACTGAAGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022217821 7:28281656-28281678 AGGGATGGTCCAGTGACAGTGGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023267626 7:38424195-38424217 AGATAGAGTTCATTGACTGTGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028461227 7:91095313-91095335 GGTGAGAGTATAGTGAATGTGGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030327015 7:108230363-108230385 AGAGAGAGTAGAGAGACTGTTGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030987882 7:116263479-116263501 AGGGAGAGAAGAGTGGCTGAAGG - Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1035899569 8:3444611-3444633 AGGGACGGTCCTGTGACTGTAGG - Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041500719 8:58535405-58535427 AGAGAGAGTCCAGTGGCGGTGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047626423 8:126660670-126660692 AGGGATAGTCCAGTGGCAGTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056955014 9:91074579-91074601 AGGCAGGGTACAGGCACTGTTGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061164887 9:128916520-128916542 AGCGAGAGGACAGTATCTGTGGG + Exonic
1061284516 9:129614461-129614483 AGCTAGAGGACATTGACTGTTGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1191194228 X:57704204-57704226 AGGGAGAGTAAGGCTACTGTGGG - Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1191909314 X:66131064-66131086 AGGGTGAGGCCTGTGACTGTCGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194464750 X:94219561-94219583 AGGGATGGTCCAGTGGCTGTGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196516498 X:116618870-116618892 AGGGACAGTACAATGACAGATGG + Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic