ID: 918363441

View in Genome Browser
Species Human (GRCh38)
Location 1:183782389-183782411
Sequence CATTACATGGACAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918363441 Original CRISPR CATTACATGGACAGGGAAGC TGG Intronic
902167355 1:14583458-14583480 GATTAGGTGGACAGAGAAGCTGG + Intergenic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
903383032 1:22909863-22909885 CATTTCCTTGACAGAGAAGCAGG + Intronic
903571332 1:24307830-24307852 CGTGACAAGGACAGGGAAGTAGG + Intergenic
903666796 1:25012961-25012983 CATTTCATGGATGGGGAAACTGG + Intergenic
904380749 1:30109140-30109162 CATCACATGGCCAGGGCAGAGGG - Intergenic
904954527 1:34271946-34271968 CATGACATGGACAAGGGATCTGG - Intergenic
906242802 1:44252295-44252317 ATTTCCATGCACAGGGAAGCAGG + Intronic
906377365 1:45305901-45305923 CATTCCATTGTCATGGAAGCAGG - Intronic
909382048 1:75009894-75009916 CTTTACATGGCCAGGGCAGGAGG - Intergenic
910607917 1:89107480-89107502 GTTTACATGGACAGAGAAGGTGG + Intronic
910924164 1:92381302-92381324 CATTTCATGTACAGATAAGCAGG + Intronic
912163790 1:107018505-107018527 CTTCAGACGGACAGGGAAGCCGG + Intergenic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
913522634 1:119660301-119660323 CATTGCATGGACATGGATGGAGG - Intronic
914381729 1:147122287-147122309 CATTCCATTGTCATGGAAGCAGG - Intergenic
916707747 1:167370201-167370223 CTTTAAATGTACAGGTAAGCTGG + Exonic
918363441 1:183782389-183782411 CATTACATGGACAGGGAAGCTGG + Intronic
921260715 1:213383213-213383235 CATTCCATCGACAGTGAACCAGG - Intergenic
922331690 1:224582547-224582569 CATTACATGTACACGTAAGAAGG - Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063217246 10:3935949-3935971 CATTAAATAGAAAGGGAAGATGG - Intergenic
1063552197 10:7043968-7043990 CATTTTATAGACAGGGAAACTGG - Intergenic
1063693444 10:8309196-8309218 CATTTCATGGACAATGAAACAGG + Intergenic
1067453757 10:46398336-46398358 CGTTCCCTGGACAGAGAAGCGGG + Intergenic
1067583470 10:47461410-47461432 CGTTCCCTGGACAGAGAAGCGGG - Intronic
1067633474 10:47986758-47986780 CGTTCCCTGGACAGAGAAGCGGG - Intergenic
1070395764 10:76010149-76010171 CATTGCATTGAGAGGCAAGCTGG + Intronic
1070773172 10:79094478-79094500 CATTTCATGGCCAAGGAATCTGG - Intronic
1071200747 10:83219110-83219132 CATTAAATGAACAGGGAAGCAGG - Intergenic
1071990273 10:91094482-91094504 TATTACATGGCCAGAGAAGGAGG + Intergenic
1075344496 10:121672197-121672219 CATTAAATGGATAGAGAAGAAGG - Intergenic
1075532429 10:123240919-123240941 CAGTAGATGGACAGGGCAGTGGG + Intergenic
1075788234 10:125064756-125064778 CACTACACAGTCAGGGAAGCAGG - Intronic
1076266154 10:129111221-129111243 CATTTCAGAGACAGGGAAGCTGG + Intergenic
1076980387 11:201044-201066 GAAGACATGGACAGGGAAGGTGG + Intronic
1077950883 11:6955419-6955441 CTTTACATGAACAAGGATGCGGG - Intronic
1079149953 11:17889037-17889059 CAATAGATAGATAGGGAAGCAGG + Intronic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084904796 11:72337292-72337314 CATTACAGGGGCAGGGGGGCGGG - Intronic
1086155367 11:83659644-83659666 CATGATATAGACAAGGAAGCTGG + Intronic
1086453786 11:86942168-86942190 CAATAAAAGGAAAGGGAAGCAGG + Intronic
1087778832 11:102282280-102282302 GCTTCCATGGTCAGGGAAGCTGG + Intergenic
1091363313 11:134995770-134995792 GACTACATAGACTGGGAAGCAGG - Intergenic
1092008188 12:5087271-5087293 CCAGACATTGACAGGGAAGCCGG - Intergenic
1092706023 12:11285727-11285749 CACTAATTGGACAGGGAAACTGG + Intergenic
1092709884 12:11324834-11324856 CATTATTTGGAAAGAGAAGCTGG + Intergenic
1092717355 12:11404523-11404545 CATTATTTGGAAAGAGAAGCTGG + Intronic
1092717740 12:11408711-11408733 CACTAATTGGACAGGGAAACTGG + Intronic
1093304797 12:17502048-17502070 AAGTACAAGTACAGGGAAGCTGG - Intergenic
1094112347 12:26875017-26875039 CATAACATGGTCAGAGAAGTTGG + Intergenic
1095202729 12:39403591-39403613 CATTTCATGTACTGGGAAACAGG - Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1097178969 12:57160069-57160091 GATGAAATGGACAGGGAAGCAGG + Intronic
1097561672 12:61214292-61214314 CATTTAATGGACAAGTAAGCTGG - Intergenic
1099805529 12:87513976-87513998 CATTAGATAGAAAGGGAAGCAGG - Intergenic
1100856720 12:98763958-98763980 CATGACATCCACAGGGAACCTGG - Intronic
1103322928 12:120102181-120102203 CATTTTATGGACAGGAAAACAGG - Intronic
1104324373 12:127782463-127782485 CATTACCTGGACAAGGGAGAGGG + Intergenic
1105770624 13:23608442-23608464 CATCTTATGGACAGGGAAACTGG + Intronic
1105974723 13:25463563-25463585 CCTTACATTGTCAGGGGAGCAGG - Intronic
1106022245 13:25926470-25926492 CAATACATGGACGGGGACTCTGG + Intronic
1107050127 13:36038145-36038167 CATTTTATGAACAAGGAAGCTGG + Intronic
1107314586 13:39117911-39117933 AAATACATGGAAAGGCAAGCTGG - Intergenic
1107879068 13:44817374-44817396 AGTCACAGGGACAGGGAAGCAGG + Intergenic
1108286956 13:48918184-48918206 CATTTTTTGGGCAGGGAAGCAGG - Intergenic
1109451131 13:62515758-62515780 CATTACCTGGAAAGGAAAGAAGG - Intergenic
1120857024 14:89221804-89221826 GATTATATAGACAGGGAAGTTGG - Intronic
1121034202 14:90686143-90686165 CATGACTTGGACAGGGATGCAGG + Intronic
1122647223 14:103203008-103203030 CCAGACATGGACAGGCAAGCTGG - Intergenic
1122663592 14:103313976-103313998 CATGACATGCACAGAGAAACAGG + Intergenic
1126539649 15:49807909-49807931 CCTTTGATGGACAGGGAAGGGGG - Intergenic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1128420979 15:67491475-67491497 CATCACCTGGGAAGGGAAGCTGG + Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1130767086 15:86881591-86881613 CTTTACATGGCCAGGGGAGGAGG + Intronic
1132329385 15:101001136-101001158 CTTTACATGCACAAGGATGCTGG + Intronic
1132539338 16:501288-501310 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132539366 16:501395-501417 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132539386 16:501467-501489 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132539416 16:501573-501595 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132539445 16:501677-501699 CATTTCATAGGCAGGGAAGCTGG + Intronic
1132539462 16:501744-501766 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132539489 16:501851-501873 CATTTCATAGGCAAGGAAGCTGG + Intronic
1132876871 16:2143896-2143918 CATTTCATGGAGAGGGGAGCAGG + Intronic
1133012393 16:2921397-2921419 CTTTCTCTGGACAGGGAAGCGGG + Intronic
1133462182 16:5996571-5996593 CAAAACATGGACAGGGAATGGGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1138208911 16:55146538-55146560 CATTTTATAGACAAGGAAGCAGG + Intergenic
1138309683 16:56012650-56012672 CATTGCAGAGACAGGGGAGCAGG - Intergenic
1141659633 16:85435123-85435145 CCTGACCTGGACAGGGAATCGGG - Intergenic
1143110865 17:4552075-4552097 CACTTCACGGACAGGGAAGGGGG + Intronic
1144685928 17:17226314-17226336 CTTTTCATGGACAGGGCTGCCGG - Exonic
1144950452 17:18990888-18990910 CATTTTATAGACAGGAAAGCTGG + Intronic
1146918077 17:36690830-36690852 CACTACATGGAAAGAGAACCAGG + Intergenic
1147302341 17:39540046-39540068 CAGTACTTGGTCAAGGAAGCAGG + Intronic
1147769184 17:42856094-42856116 CAAGCCAGGGACAGGGAAGCAGG + Intronic
1149302142 17:55315329-55315351 CATTTCCTGGCCAGGGATGCTGG - Exonic
1150128675 17:62654343-62654365 CATTCCAAGGACAAGGAAGGCGG - Intronic
1155290437 18:24335679-24335701 CAAGTCATGGACAGAGAAGCAGG + Intronic
1156408770 18:36807850-36807872 CATGACATGGAGTGTGAAGCTGG - Exonic
1157505709 18:48225045-48225067 GATTACCTGGACTGGGAAGAGGG - Intronic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1159447672 18:68560174-68560196 CATTTCTTGGAAAGAGAAGCTGG + Intergenic
1161217191 19:3100418-3100440 AATGACATGGGCAGGGAAGCAGG - Intronic
1161677957 19:5663607-5663629 CAGTACATGGCCAGGGCTGCTGG + Intronic
1163595317 19:18218030-18218052 CATTTCATAGACAGGGAGACTGG + Intronic
1164038565 19:21474686-21474708 CATTTTATGGGCAGGGAAACAGG - Intronic
1164079800 19:21852189-21852211 CATTTTATGGACAGGGAAACAGG + Intergenic
1164208173 19:23075058-23075080 CATTTTATGGACAGGGAAAGAGG - Intergenic
1164261291 19:23570326-23570348 CATTTTATGGACTGGGAAACAGG + Intronic
1166617375 19:44262299-44262321 CAAGAGAAGGACAGGGAAGCTGG + Intronic
925721967 2:6838280-6838302 CATCACATGTACAAGGAGGCAGG + Intergenic
925930425 2:8702921-8702943 CTTTAAATAGACAGGGAGGCAGG + Intergenic
927237415 2:20886905-20886927 CCTTTCAGTGACAGGGAAGCTGG + Intergenic
928078517 2:28287597-28287619 GATTATATGGACATGGAGGCTGG + Intronic
929341178 2:40819770-40819792 AATCACATGGACAGGGATGAAGG - Intergenic
930386505 2:50702116-50702138 CATTACATGGTCAGGTAAGTAGG + Intronic
932345992 2:70995334-70995356 CATTTTATAGACGGGGAAGCCGG + Exonic
935601900 2:104930684-104930706 CATTAGATGTACAAGGAGGCAGG + Intergenic
937102915 2:119285475-119285497 CAACACATGAACAGGGAAACGGG - Intergenic
939541922 2:143504811-143504833 CAGTACCTAGGCAGGGAAGCAGG - Intronic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948802402 2:240438829-240438851 CATTTTATGGGCAAGGAAGCAGG + Intronic
1170015411 20:11775742-11775764 CATTACATGGCCAAGGCAGGAGG - Intergenic
1170157744 20:13284133-13284155 CAGTAGATCGACAGGGCAGCTGG + Intronic
1173430854 20:42986075-42986097 CATTCCATGAACAGAGCAGCAGG + Intronic
1174104178 20:48150531-48150553 CATTTCATTGACAGGGAAAGGGG + Intergenic
1174553231 20:51376252-51376274 CATCACATGGGCAGAGCAGCAGG + Intergenic
1175903890 20:62370574-62370596 TATTTCATGGACAGGGATGGAGG - Intergenic
1176061195 20:63173679-63173701 CAGTGCATGGCCAGGGAGGCTGG + Intergenic
1178484364 21:33008339-33008361 CATTATAAGGATAGGGAACCAGG - Intergenic
1178847336 21:36184568-36184590 TATTCCAGGGACAGGGAAGCAGG + Intronic
1179138531 21:38701503-38701525 CATCACATGGACAAGGAAAGGGG + Intergenic
1180011623 21:45055077-45055099 CATTACATGAAGTGGGAAGGTGG - Intergenic
1182061261 22:27399457-27399479 CAGTACATGGAACGAGAAGCAGG + Intergenic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182784792 22:32898375-32898397 CCTTACATAGACAAGGAAACTGG - Intronic
1185003269 22:48259610-48259632 CATTTCATGGGCAAGAAAGCAGG + Intergenic
1185102658 22:48850007-48850029 CATTACTGGGACAGGGAAGATGG + Intronic
950667171 3:14504679-14504701 TGTTACATGGAAAGGGAAGGAGG - Intronic
952499592 3:33948101-33948123 CATCACATGTACATGAAAGCTGG + Intergenic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
954189207 3:48944530-48944552 CTTTACAGGGACATGGAAGGAGG - Intronic
954650167 3:52156391-52156413 CCTTCCATCGTCAGGGAAGCAGG - Intergenic
955326857 3:58015187-58015209 CATTTTATAGACAGGGAAGCAGG - Intronic
955410876 3:58654559-58654581 CTTTACAGGGACCGGAAAGCAGG + Intronic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
955800069 3:62677416-62677438 TATTACTTGGATAGGGAAGGGGG + Intronic
958941928 3:100326345-100326367 CATTGCTTGAACAGGGAAGGTGG - Intergenic
961918746 3:130404116-130404138 CCTTCCATGGAAAGGGAAGTCGG + Intronic
962019822 3:131487146-131487168 CTTTGCAGGGACATGGAAGCTGG + Intronic
962694277 3:137932193-137932215 CATTATTTGGACAGGAAAGGAGG + Intergenic
966651235 3:182303408-182303430 TATTACTTGGAAAGGGAAGGAGG - Intergenic
969144433 4:5109062-5109084 CATTAACTGGACAAGGAAGCTGG - Intronic
969339067 4:6529103-6529125 CCTCACAGGGACAGGGAAGGGGG + Intronic
969924982 4:10576959-10576981 CTTTGCAGGGACAGGGTAGCTGG + Intronic
972382387 4:38531481-38531503 GATTCCAAGGACAGAGAAGCTGG - Intergenic
978200102 4:106015926-106015948 CATTTTATGGATAGGGAAACTGG + Intergenic
980365679 4:131802161-131802183 ATTTCCATGGACAGGGGAGCAGG + Intergenic
981741426 4:148006267-148006289 CAGTGCCTGGACAGGAAAGCTGG - Intronic
983678876 4:170329453-170329475 CATGAAATGGAGAGTGAAGCAGG + Intergenic
984034049 4:174643951-174643973 CATTACCTGGACAGGGTGGTTGG + Exonic
985108421 4:186521433-186521455 GATCACATGGGCAGAGAAGCGGG - Intronic
985664558 5:1175325-1175347 CACTCCATGGACAAGAAAGCTGG - Intergenic
986506098 5:8453331-8453353 TATTTTATGGAAAGGGAAGCAGG - Intergenic
991526047 5:67559020-67559042 TATTTCAAGGACAGGGAAGTTGG - Intergenic
995640237 5:114248162-114248184 TTTTACATGGACAGGAAAGAGGG + Intergenic
996415286 5:123203950-123203972 TCTTACATGGAAAAGGAAGCTGG - Intergenic
996683054 5:126249230-126249252 CATTACATAGACAAGGGAGAGGG - Intergenic
997824961 5:137098179-137098201 CATTTCATGGACAAGGAAACTGG + Intronic
1002953658 6:1840934-1840956 CATTACGTGTACAGTGTAGCTGG - Intronic
1003458201 6:6304374-6304396 AAATACATGCACAGAGAAGCAGG - Intronic
1007687102 6:43673500-43673522 CATGCCTTGGAGAGGGAAGCTGG + Intronic
1009874511 6:69488929-69488951 CATTAGATGTAATGGGAAGCAGG + Intergenic
1010167955 6:72939557-72939579 CAATACATGTTCAGGGAGGCAGG - Intronic
1011217770 6:85023375-85023397 CATTGCATGGACAGAAAGGCTGG - Intergenic
1011725415 6:90205701-90205723 AATTTCCTGGACAGGGAAGGTGG - Intronic
1014356033 6:120411412-120411434 CATTTTATGGACAGGGGAGTAGG - Intergenic
1014467324 6:121772492-121772514 CATTCCATAAACAGGGAAACGGG + Intergenic
1014470949 6:121814183-121814205 CATACCAAGGACAGGGAAGTGGG + Intergenic
1015805273 6:137102210-137102232 CATTAGATGGGGAGGGAAGGAGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017614278 6:156228204-156228226 CATTGCCTGGTCAGGGCAGCAGG + Intergenic
1019256453 7:55434-55456 CATTACCTGGACACTGGAGCAGG - Intergenic
1019734797 7:2645322-2645344 CATTTCATCCACAGGGAAACTGG - Intronic
1020115310 7:5472919-5472941 CATTACAGTGACAGGCAAGCGGG - Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1022127470 7:27372274-27372296 CATTACATGGTGAGGGAGGAAGG + Intergenic
1023593173 7:41800191-41800213 CATTACATGGACAGGCACAAGGG + Intergenic
1023849739 7:44144016-44144038 CATTCCATGGGCAGGCAAGCAGG + Intergenic
1025991736 7:66502761-66502783 CATGACATGGTCAGAGAAGGTGG + Intergenic
1026593955 7:71718621-71718643 GATTACTTGGACAGGTAGGCGGG - Intergenic
1033489651 7:141829753-141829775 TCTTACATGGCTAGGGAAGCAGG - Intergenic
1034397691 7:150839652-150839674 GATGACATGGACAAGGAAGATGG - Intronic
1034450219 7:151133269-151133291 AGTGACAGGGACAGGGAAGCAGG + Intronic
1036185048 8:6615298-6615320 CATTTCATGGGCAGGAAAGTGGG - Intronic
1036196557 8:6721816-6721838 TTTTACATGCACAGGGAAGGAGG + Intronic
1038729755 8:30116362-30116384 TTTTCCATGGACAGGGAGGCGGG + Intronic
1039864109 8:41486190-41486212 CATTCCCTGGACAGAGAGGCTGG + Intergenic
1045068031 8:98469577-98469599 CTTTACATCTACTGGGAAGCCGG + Intronic
1047443083 8:124896425-124896447 CAAAACAGGTACAGGGAAGCAGG + Intergenic
1051274655 9:15387182-15387204 CTTCACATGGCCAGGGCAGCAGG - Intergenic
1051300115 9:15640918-15640940 CTTTACCTGGGCAGGGAAGGGGG - Intronic
1053362119 9:37495794-37495816 CATTTCACAGACAGGGAAACAGG - Intronic
1053651230 9:40171594-40171616 TATTACATAGACAGAGAAGTTGG - Intergenic
1054533350 9:66204609-66204631 TATTACATAGACAGAGAAGTTGG + Intergenic
1054812810 9:69448018-69448040 GATTGCATGGAGAGGCAAGCGGG - Intronic
1057905645 9:98981011-98981033 AATTACCTGCACAGGTAAGCAGG + Intronic
1058883817 9:109307752-109307774 CATCACATGGGCAGGAGAGCTGG + Intronic
1187845698 X:23534053-23534075 CATTACATGAAAAGAGAAACTGG + Intergenic
1188657491 X:32716360-32716382 CCTTACATGGCCAGAGAAGGAGG - Intronic
1189494830 X:41499585-41499607 CATCTCATGGACAGGGACACTGG + Intergenic
1190171184 X:48113611-48113633 CATTTCATGGACCAGGAATCTGG - Intergenic
1190177283 X:48161356-48161378 CATTTCATGGACCAGGAATCTGG - Intergenic
1190189170 X:48262184-48262206 CATTTCATGGACTAGGAATCTGG - Intronic
1190194000 X:48301322-48301344 CATTTCATGGACCAGGAATCTGG + Intergenic
1190196368 X:48322764-48322786 CATTTCATGGACCAGGAATCTGG - Intergenic
1190199883 X:48351721-48351743 CATTTCATGGACCAGGAATCTGG + Intronic
1190655470 X:52608249-52608271 CATTTCATGGACCAGGAATCTGG + Intergenic
1190660517 X:52649962-52649984 CATTTCATGGACCAGGAATCTGG + Intronic
1190666664 X:52702202-52702224 CATTTCATGGACCAGGAATCTGG + Intronic
1190672754 X:52756206-52756228 CATTTCATGGACCAGGAATCTGG - Intronic
1193436222 X:81477784-81477806 CATATCAAGGACAGGGGAGCAGG + Intergenic
1198249659 X:134867800-134867822 CAATACATAGAAAGGGAAACTGG - Intergenic
1198878000 X:141248552-141248574 CCTTCCATTGACATGGAAGCAGG + Intergenic
1199372640 X:147069400-147069422 CATAACTTGGTCAGGGAAGAGGG - Intergenic
1200155845 X:153974552-153974574 CAGGACATGGAATGGGAAGCTGG + Intronic