ID: 918363976

View in Genome Browser
Species Human (GRCh38)
Location 1:183787283-183787305
Sequence GAGTAGAGTTTTAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918363976_918363979 -2 Left 918363976 1:183787283-183787305 CCTACCACCTTAAAACTCTACTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 918363979 1:183787304-183787326 TCACATTTTAAGTCTCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 212
918363976_918363980 10 Left 918363976 1:183787283-183787305 CCTACCACCTTAAAACTCTACTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 918363980 1:183787316-183787338 TCTCCTTCAGGATGCCTTAATGG 0: 1
1: 0
2: 0
3: 13
4: 132
918363976_918363982 12 Left 918363976 1:183787283-183787305 CCTACCACCTTAAAACTCTACTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 918363982 1:183787318-183787340 TCCTTCAGGATGCCTTAATGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
918363976_918363981 11 Left 918363976 1:183787283-183787305 CCTACCACCTTAAAACTCTACTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 918363981 1:183787317-183787339 CTCCTTCAGGATGCCTTAATGGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918363976 Original CRISPR GAGTAGAGTTTTAAGGTGGT AGG (reversed) Intronic
900410553 1:2510658-2510680 GAGGTGAGTGTTGAGGTGGTGGG - Exonic
903840426 1:26234783-26234805 GTGTAGAGAATTAAGGTTGTGGG + Intronic
905999939 1:42415979-42416001 AAGTAGAGTTTCAAGGGGATTGG - Exonic
906220610 1:44075911-44075933 GAGTAGAGTTGCTAGGTTGTAGG + Intergenic
914954958 1:152153659-152153681 GAGAAGAGTTTTCAGGTCTTAGG + Exonic
917599782 1:176562578-176562600 GAGCAGAGTTCTAATGTGGAGGG - Intronic
918363976 1:183787283-183787305 GAGTAGAGTTTTAAGGTGGTAGG - Intronic
919749765 1:201030067-201030089 GAGGAATGTTTTGAGGTGGTGGG + Intergenic
923642969 1:235784324-235784346 GAGTATAGCTGTAAGTTGGTGGG + Intronic
1073856820 10:107685628-107685650 GAGGAGAGTTATGAGGTGGCAGG - Intergenic
1074931512 10:118131354-118131376 GAGCAGAATGTGAAGGTGGTTGG + Intergenic
1075824694 10:125345174-125345196 GGCAAGAGTTTGAAGGTGGTAGG - Intergenic
1075848901 10:125569689-125569711 GAGTAAATGTTTAAGGTGGCAGG - Intergenic
1076083685 10:127606313-127606335 GTGTCCAGTTTTAAGTTGGTGGG + Intergenic
1079107131 11:17578775-17578797 CAGTAGCCTGTTAAGGTGGTAGG - Intronic
1079260773 11:18878145-18878167 GAGTGGTGTTTTAAGGAGATAGG + Intergenic
1080384194 11:31800926-31800948 GAGTTGCTTTTTAAGGTTGTGGG - Intronic
1088592700 11:111416940-111416962 GAGTAGATTTTTAAGGGAGCCGG + Intronic
1089259272 11:117212150-117212172 GAGTAGATCTCAAAGGTGGTAGG - Intronic
1093062972 12:14626501-14626523 AAGTAGAGTTATAAGCTGATTGG - Intronic
1093704321 12:22257751-22257773 GAGTAGACTATTAGGGAGGTTGG + Intronic
1094720123 12:33054639-33054661 GTATAGAATTTCAAGGTGGTGGG + Intergenic
1095712777 12:45308125-45308147 GAAGAGAGTTTTAAGATGGCAGG + Intronic
1096516795 12:52160577-52160599 GAGCAGAGTCTTGAGGTGGATGG + Intergenic
1100663116 12:96722137-96722159 GCTTGGAGTTTTATGGTGGTTGG - Intronic
1106590364 13:31093369-31093391 GATTAGAGTTACAAGGTGTTAGG - Intergenic
1109696020 13:65959100-65959122 GTATAGAGCTTTAATGTGGTAGG + Intergenic
1110602868 13:77395889-77395911 GAGTAGGGTTTGTGGGTGGTAGG + Intergenic
1114813259 14:25926323-25926345 GAGTAGAGTTGGAAGGCAGTTGG + Intergenic
1115412758 14:33094130-33094152 GACTAGCTTTGTAAGGTGGTGGG - Intronic
1116422880 14:44753167-44753189 GAGGAGAAATTTAAGGTGGCAGG + Intergenic
1118038330 14:61892139-61892161 GAGGAGAGGTTTATGGTGGGAGG - Intergenic
1118436901 14:65779783-65779805 GAGTGGAGACTGAAGGTGGTTGG - Intergenic
1118988390 14:70776603-70776625 GAGCAGAGCTTTAAGATCGTAGG - Intronic
1120290917 14:82569757-82569779 GAGTAGGATTTTAAGGAGGATGG - Intergenic
1125357200 15:38828720-38828742 CAGTAAAGTTTGAAGGTGTTTGG + Intergenic
1125986059 15:44053339-44053361 CATTAGAGTTTTAAGGAGGGTGG + Intronic
1126199307 15:45967915-45967937 CAGTAGCTTTTTAAGGTGGCTGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131286885 15:91066934-91066956 GGGTACAGTTTGAAGGAGGTGGG + Intergenic
1133812843 16:9174555-9174577 GAGAAGAATTTTAAGAGGGTGGG - Intergenic
1133813019 16:9175906-9175928 GAGTGGAGTTGCCAGGTGGTGGG + Intergenic
1134287946 16:12878939-12878961 GTGTCTAATTTTAAGGTGGTAGG - Intergenic
1138228010 16:55315487-55315509 TGGTAGGGTTTTAAGGTGCTGGG - Intergenic
1138281753 16:55777529-55777551 GAGTTGAGATATAAGGTGGCTGG - Intergenic
1138287117 16:55818886-55818908 GAGTTGAGATATAAGGTGGCTGG + Intronic
1138466695 16:57198077-57198099 TAGTACAATTTTAAGGTGATTGG - Intronic
1140039039 16:71393273-71393295 AAGATGGGTTTTAAGGTGGTGGG + Intergenic
1140154756 16:72412456-72412478 CAGTAGAATTTGAGGGTGGTGGG - Intergenic
1146585940 17:34081572-34081594 GAGAAGGATTTTGAGGTGGTGGG - Intronic
1146955729 17:36935548-36935570 AAGTGGAGTCTGAAGGTGGTTGG - Intergenic
1149085177 17:52708376-52708398 GGGTAGTGTTTCAATGTGGTTGG - Intergenic
1155989397 18:32264112-32264134 AAGTAGAGTTTTTAGATTGTGGG - Intronic
1156501524 18:37562664-37562686 GAGTAATTTTTTAAGGTGGCCGG + Intronic
1158260900 18:55604753-55604775 GAGTGGAGTTATAAGAAGGTTGG + Intronic
1161341918 19:3747707-3747729 GACCAGAGTTTGAAGGTGGGGGG + Intronic
1165840790 19:38788243-38788265 GAGGTGGGTTTTAGGGTGGTGGG - Intergenic
1168378105 19:55897779-55897801 GAATAGAGGTTTGAGGTGGCTGG + Intronic
926969446 2:18452222-18452244 GAGAAGAGCAATAAGGTGGTTGG - Intergenic
927254861 2:21032246-21032268 GAGCAGAGTTTGAAAGTGGAAGG + Intronic
930309625 2:49723430-49723452 CAGTAGAGTTGTAGGGTGGGAGG + Intergenic
930430772 2:51273092-51273114 TATTAGAGTTTTAAGATTGTTGG + Intergenic
931067724 2:58605406-58605428 GAGGAGATGTTTAAGCTGGTAGG - Intergenic
935304241 2:101721402-101721424 GAGTAGCGTGTTAAGGGGTTGGG + Intronic
938895546 2:135746601-135746623 GAGCAAAGTTTTAAGGGAGTTGG + Intronic
939268084 2:139901561-139901583 GTGTAAAGTTTTAAGTTGCTTGG - Intergenic
940219678 2:151338777-151338799 GATTAGAGGTTTTTGGTGGTTGG - Intergenic
941273878 2:163465597-163465619 GAGCAGCGTTTTAATGTGATTGG + Intergenic
941891802 2:170590346-170590368 GAGTAGACACCTAAGGTGGTTGG + Intronic
941950838 2:171154921-171154943 GAGTTGGATTTTTAGGTGGTGGG - Intronic
947899741 2:233711431-233711453 GCATACAGTTTTAAGGGGGTTGG + Intronic
947901830 2:233727577-233727599 GCATATAGTTTTAAGGGGGTTGG + Intronic
947992787 2:234499546-234499568 GCTTTAAGTTTTAAGGTGGTAGG + Intergenic
1171992255 20:31705668-31705690 GAGAAGGGTTTAAAGGTGCTGGG + Intronic
1182360776 22:29745232-29745254 GACTTGAGTTCTGAGGTGGTGGG + Intronic
951639499 3:24820341-24820363 GAGTAGATTTGCAAGGTTGTAGG - Intergenic
953095826 3:39775946-39775968 GAGTAGATTTTCGAGGTGGGCGG - Intergenic
959018191 3:101159463-101159485 GAGGAGAGTTTAAAGATAGTAGG - Intergenic
960311218 3:116118555-116118577 TAGTAGAGTTTGCAGGGGGTGGG + Intronic
961529864 3:127533857-127533879 GAGTAGTGTTGTCAGGTGATGGG - Intergenic
962365815 3:134779678-134779700 GATCAGAGCCTTAAGGTGGTGGG + Intronic
962728721 3:138259732-138259754 GAGTATAGCTATAAGGTGGCTGG - Intronic
963250862 3:143102343-143102365 ATGTGGAGGTTTAAGGTGGTGGG + Intergenic
965755470 3:172021845-172021867 GAGTAGAGTCTTATGGGGGTTGG + Intergenic
967526461 3:190500313-190500335 GAGTAAAGTGTTAAGATGGTAGG - Intergenic
969885454 4:10211336-10211358 GATTAGAGATTTAAGGAAGTTGG - Intergenic
971382439 4:26111201-26111223 GAGAAGAGTTTGAAGGAGGGGGG - Intergenic
972356561 4:38284590-38284612 GAGAAGAGTTATAAGCAGGTTGG + Intergenic
974687979 4:65256101-65256123 GAGTAGAGGTGCAAGTTGGTTGG + Intergenic
978902556 4:113970204-113970226 GAGTAGAGTTTGAAGGTAGAAGG + Intronic
979470897 4:121094416-121094438 GAGGAGATTTTTAAGGATGTAGG + Intergenic
981245404 4:142531107-142531129 GACTAGAGCTTTAAGGTAGGGGG + Intronic
982301518 4:153883447-153883469 GAGGAGAGTTTTATGATGTTAGG + Intergenic
982498287 4:156119801-156119823 GTGCAGAGCTTTAAGTTGGTGGG - Intergenic
983887675 4:172998717-172998739 GAGAAGAGTTTCAAGGTGGGAGG - Intronic
983981078 4:173998127-173998149 TAGTAGTGTTTTAGGGTGGATGG - Intergenic
988392256 5:30649966-30649988 GAGTGAAGTTTTGAGGTTGTTGG + Intergenic
993442176 5:87970823-87970845 GAGTAGACTTCTGAGGTGCTGGG - Intergenic
994855927 5:105118876-105118898 AAGTAGAGATTTAAGGGGGAGGG + Intergenic
995786955 5:115841011-115841033 GAGTAATGTTTTATGGTGGTAGG - Intronic
996226266 5:121000861-121000883 GAGGAGTGTATTAAGGTGGTTGG + Intergenic
997722089 5:136087422-136087444 GGGTAGAGTTGGAAGGTGGGAGG + Intergenic
998797919 5:145838420-145838442 AAGTAGAGGTTGCAGGTGGTGGG - Intergenic
1003378574 6:5602170-5602192 GAGAAGAGTTTTAAGGTAAGGGG + Intronic
1007759463 6:44125050-44125072 GAGTCCACTTTTCAGGTGGTTGG - Intronic
1008669429 6:53752152-53752174 GAGTAGAGGTTCTAGGGGGTTGG + Intergenic
1011847615 6:91585999-91586021 GAATAAAATTTTAAGGTGATTGG - Intergenic
1011863359 6:91788712-91788734 GGCTAGAGTGGTAAGGTGGTGGG + Intergenic
1011920853 6:92576130-92576152 GTGTAGATTTTTCAGGTAGTAGG - Intergenic
1012929965 6:105306589-105306611 GAGAAGAGTTTCAAGGAGGATGG - Intronic
1014746431 6:125206014-125206036 GAATAGATGTTTAATGTGGTCGG + Intronic
1015093774 6:129389891-129389913 GAGATGAGATTTGAGGTGGTCGG + Intronic
1015842896 6:137492512-137492534 GAATAAAGTTTGAAGGGGGTGGG + Exonic
1017873171 6:158503096-158503118 GAGGACAGTTTTAAGGGGTTGGG - Exonic
1020928389 7:14361212-14361234 GAGAGAAGTTTTAAGGTGATTGG - Intronic
1022501470 7:30884665-30884687 GTGGAGAGGTTTCAGGTGGTGGG - Intronic
1024353784 7:48394230-48394252 GAGGAGGGTTTTGAGGTGGAAGG - Intronic
1026324069 7:69293592-69293614 GAGTGGCCTTTTAGGGTGGTGGG + Intergenic
1028410813 7:90528756-90528778 GAGTGGAGTTTTAAGCTAGGTGG - Intronic
1030097737 7:105915954-105915976 GAGTAGAATTTTAAACTGGACGG - Intronic
1031915051 7:127555082-127555104 GAATAGAGTTTTAAAGTCCTGGG - Intergenic
1032572919 7:133020353-133020375 GAGTGGAGATTTAATGGGGTTGG + Intronic
1033296399 7:140141364-140141386 TGGTAGAGTTTTAGGGTGGGGGG - Intronic
1036160267 8:6381110-6381132 GATTAGAATTTAAAGGGGGTTGG + Intergenic
1037127639 8:15370075-15370097 GAGTAGAGTTTTAGGAATGTTGG - Intergenic
1038065415 8:23958668-23958690 GAGTTGAGTTCTATAGTGGTTGG + Intergenic
1041174635 8:55181829-55181851 GAGAAGATTTTTAAGCTGATTGG - Intronic
1044279243 8:90337300-90337322 GAGCAGAATTTTAAGGGAGTAGG - Intergenic
1044695239 8:94916109-94916131 GTGAGGAGTTTTAAGGTTGTTGG + Intronic
1045043498 8:98250721-98250743 GCTCAGAGTTTTAAGGTGGGTGG + Intronic
1045370657 8:101519110-101519132 GAGTAGAGATTTCAGGTGAAAGG - Intronic
1045475671 8:102550296-102550318 GAGAAGACTTTTAAGGTGAGTGG + Intergenic
1049947816 9:614833-614855 GAGCAGAAGTTTAAGGTGATGGG - Intronic
1051140855 9:13977659-13977681 GACCAGATTTATAAGGTGGTTGG + Intergenic
1051525121 9:18034362-18034384 GAGGAGAGTTTGAAGGAGGGTGG - Intergenic
1057768099 9:97941306-97941328 GAGGGGAGTGTTAAGGAGGTGGG + Intronic
1057871495 9:98721643-98721665 GGGTGGAGTTTAAAGTTGGTGGG - Intergenic
1058639941 9:107073852-107073874 GAGTAGAGTATTATGGTGGCTGG - Intergenic
1186576649 X:10773821-10773843 GAGTAGAGGTTTAAGTTTGTTGG + Intronic
1188078982 X:25813518-25813540 GACTAGAGTTTTAAAGTTGTTGG + Intergenic
1196468667 X:115999367-115999389 GAGTAGAGATGGAAGGGGGTAGG - Intergenic
1196930863 X:120680876-120680898 TTTTATAGTTTTAAGGTGGTAGG + Intergenic