ID: 918364055

View in Genome Browser
Species Human (GRCh38)
Location 1:183787911-183787933
Sequence CAGGCTACTTCCACTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 2, 1: 12, 2: 127, 3: 269, 4: 797}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918364055_918364060 6 Left 918364055 1:183787911-183787933 CCACTATGAGTGGAAGTAGCCTG 0: 2
1: 12
2: 127
3: 269
4: 797
Right 918364060 1:183787940-183787962 TCAGCAGATGCAGATGCTGGTGG 0: 1
1: 1
2: 7
3: 75
4: 547
918364055_918364058 3 Left 918364055 1:183787911-183787933 CCACTATGAGTGGAAGTAGCCTG 0: 2
1: 12
2: 127
3: 269
4: 797
Right 918364058 1:183787937-183787959 CCCTCAGCAGATGCAGATGCTGG 0: 2
1: 47
2: 362
3: 756
4: 1104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918364055 Original CRISPR CAGGCTACTTCCACTCATAG TGG (reversed) Intronic
900900903 1:5515210-5515232 CAGGCTGCTTCCACTCATGGTGG + Intergenic
901189284 1:7396285-7396307 CAAGCTTTTTCCACTCATGGTGG - Intronic
901214090 1:7544746-7544768 CACGCAGCTTCCACTCATGGTGG + Intronic
901518272 1:9764035-9764057 CAGGCTACTTCCACTCACTGCGG + Intronic
901753472 1:11426602-11426624 CAGGGAACTTACAATCATAGTGG - Intergenic
902366828 1:15981080-15981102 CAGGCAACTTCCAATCATGGTGG + Intergenic
902541491 1:17158771-17158793 CAGGCTGCTTCCACTCATGGAGG - Intergenic
902899201 1:19502471-19502493 CAGGAAACTTACAATCATAGCGG - Intergenic
903297922 1:22357302-22357324 CAGGCAACTTACAATCATGGTGG + Intergenic
905042442 1:34971210-34971232 CAGTCTGCTTCCACTCATGGCGG - Intergenic
905402827 1:37715946-37715968 CAAGCAACTGCCACTCAAAGAGG + Intronic
905654541 1:39677570-39677592 GGGGCTGCTTCCACTCAGAGGGG + Intergenic
905855528 1:41309098-41309120 CAGGAAACTTCCAATCATGGCGG - Intergenic
905965549 1:42092467-42092489 CAGGCTGTTTCCACCCATGGTGG + Intergenic
906591184 1:47025285-47025307 CAGACGGCTTCCACTCATAGTGG - Intronic
906708042 1:47909330-47909352 CAGGCTGCTTCCACTCCTGGCGG + Intronic
907295116 1:53446007-53446029 CAAGCTGCTTCCATTCATGGTGG + Intergenic
907829682 1:58052932-58052954 TAGGCTGCTTCCACTCATTATGG + Intronic
908211743 1:61907118-61907140 CAGGAAACTTACAATCATAGGGG - Intronic
908390598 1:63680015-63680037 CAGGCTGCTTCCACTCATGGTGG - Intergenic
908470002 1:64434425-64434447 CAGGCTGCTTCCACTCATAGTGG - Intergenic
908815477 1:68028507-68028529 CAGGAAACTTACAATCATAGTGG + Intergenic
908838156 1:68249602-68249624 CAGGAAACTTACAATCATAGCGG + Intergenic
909385783 1:75054704-75054726 CAAGCTACTTCCACTGGTAAGGG - Intergenic
909492527 1:76241333-76241355 CAAACTGCTTCCACTCATGGTGG + Intronic
909607942 1:77525463-77525485 CAGGAAGCTTCCACTCACAGCGG + Intronic
909849508 1:80442644-80442666 CAGGCTACATCCACTCACGGTGG + Intergenic
909974073 1:82025101-82025123 CAGGAAACTTACAATCATAGAGG + Intergenic
910072742 1:83238653-83238675 CAGGCTGCTTCCACTGATTGTGG - Intergenic
910123753 1:83818298-83818320 CAGGATGTTTCCACTCATGGTGG - Intergenic
910124069 1:83820739-83820761 CAGGTTGCTTCCACTCATGGAGG - Intergenic
910472774 1:87572921-87572943 CAGGAAACTTCCAATCATGGTGG + Intergenic
911222601 1:95264905-95264927 CAGGAAACTTACAATCATAGTGG + Intergenic
911858203 1:102909302-102909324 CAGGCTGCTCCCACTCATGCTGG - Intronic
911880102 1:103225905-103225927 CTGGCTGCTTCCAGTCATGGAGG - Intergenic
912195374 1:107391632-107391654 CAGGAAGCTTCCACTCATGGTGG + Intronic
912501415 1:110124791-110124813 CAAGCTACTTCCACTCATGTTGG - Intergenic
912656824 1:111493445-111493467 CATGCTGCTTCCACCCATGGTGG - Intronic
913076685 1:115346039-115346061 CAGGAAGCTTCCACTCATGGTGG - Intergenic
914235491 1:145806710-145806732 CAGGAAGCTTCCAGTCATAGTGG - Intronic
914437803 1:147675408-147675430 CAGGCTGCTTCCACTCATGGTGG - Intergenic
916384721 1:164254676-164254698 CAGGAAACTTACAATCATAGTGG - Intergenic
916482169 1:165224210-165224232 CAGGAAACTTGCAATCATAGAGG - Intronic
916884938 1:169058178-169058200 CAGGGGGCTTCCACTCATGGTGG - Intergenic
916899648 1:169207121-169207143 CAGGCTGTTTCTACTCATGGTGG + Intronic
917068441 1:171123294-171123316 CAGGCTGCTTCCACTCATGATGG + Intergenic
917265064 1:173212031-173212053 CATGGTGCTTCTACTCATAGTGG + Intergenic
917541872 1:175922312-175922334 CAGGCTGCTTCCATTCATGGTGG + Intergenic
917658526 1:177153306-177153328 TAGGCTGCTTCCACTCATGGTGG - Intronic
917813034 1:178678967-178678989 CAGATTGCTTCCACTCATAGTGG + Intergenic
918130537 1:181624029-181624051 CAAGCTGCTCCCACTCATGGTGG + Intronic
918157931 1:181868433-181868455 CAGGCTGCTTCCACTTATGGTGG + Intergenic
918364055 1:183787911-183787933 CAGGCTACTTCCACTCATAGTGG - Intronic
918550936 1:185741120-185741142 CATGCTGCTTCCATTCACAGTGG - Intronic
918689165 1:187458643-187458665 CAGGAGACTTACAATCATAGCGG - Intergenic
918719805 1:187838817-187838839 CCGGCTACTTTCACTCATGACGG - Intergenic
919331013 1:196171801-196171823 CATGCTACTTCCACTAGTAAGGG - Intergenic
919366510 1:196668717-196668739 CAGGAAACTTACAATCATAGTGG - Intronic
920741554 1:208585878-208585900 CAGGAAACTTACACTCATGGTGG - Intergenic
920798556 1:209164224-209164246 CAGGAAACTTACAATCATAGTGG - Intergenic
921284853 1:213600150-213600172 CAGGAAACTTACACTCATGGTGG - Intergenic
921438515 1:215156703-215156725 CAGGATACTTACAGTCATGGCGG + Intronic
921457618 1:215390764-215390786 CAGGATACTTACAATCATGGTGG + Intergenic
921593674 1:217031852-217031874 CAGGAAACTTCCAATCATGGTGG - Intronic
921812303 1:219529057-219529079 CATGCTGCTTCTACTCATTGTGG + Intergenic
921887293 1:220319812-220319834 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
921960401 1:221027869-221027891 CAGGAAGCTTCCACTCATGGTGG - Intergenic
922073411 1:222218421-222218443 CAGGAAGCTTCCACTCATGGTGG - Intergenic
922741514 1:228016755-228016777 CAGGGAGCTTCCACTCATGGTGG + Intronic
922876760 1:228945873-228945895 CAGGCTGCTGCCACTCATGGTGG + Intergenic
923005608 1:230047108-230047130 CTGGCTGCTTCCACTCATGATGG + Intergenic
923325649 1:232877861-232877883 CAGGCTGCTTCCACTCATGGTGG - Intergenic
923370837 1:233310789-233310811 CAGGCTGCTTCCACTCATAGTGG + Intergenic
923466383 1:234250747-234250769 CAGACTGCTTCCACTCATGATGG + Intronic
923920266 1:238556222-238556244 CAGGTTCCTTCCACTCATGGTGG + Intergenic
924021584 1:239789531-239789553 CAGGCTGCTTCCACTCATGGAGG + Intronic
924077268 1:240353261-240353283 CAGGCATTTTACACTCATAGTGG + Intronic
924294416 1:242570843-242570865 CAGGCTGCTTCCACTCATGGAGG + Intergenic
924710449 1:246526771-246526793 CAGGAAACTTCCAATCATGGCGG + Intergenic
924936476 1:248776352-248776374 CAGGAAACTTACAATCATAGTGG - Intergenic
1063006339 10:1974599-1974621 CAGGAAACTTCCAATCATGGTGG + Intergenic
1063770256 10:9189379-9189401 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1064161966 10:12954533-12954555 CAGGAAGCTTCCACTCATGGTGG + Intronic
1064531177 10:16311790-16311812 CAGGTTGCTTCTACTCATGGTGG + Intergenic
1064851710 10:19715746-19715768 CAGGCAACTTACAATCATGGCGG + Intronic
1064864016 10:19858956-19858978 CAGGAAGCTTCCACTCATGGTGG + Intronic
1065086215 10:22180075-22180097 CAGGCTGCTTCCACTCGTAGTGG - Intergenic
1065149723 10:22810631-22810653 CTGGCTGTTTCCACTCATAGTGG + Intergenic
1065256505 10:23874948-23874970 CAGGAAACTTCCAGTCATGGTGG + Intronic
1065416403 10:25492059-25492081 CAGGCTGCTTCCACTCATGGTGG + Intronic
1065624690 10:27618575-27618597 CAGGCTGCTTCCACTTAGCGAGG + Intergenic
1065787157 10:29227294-29227316 CAGGCTGCTTCCATTAATGGTGG + Intergenic
1065863075 10:29887709-29887731 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1065905536 10:30247948-30247970 CAGGCAACTTGCAATCATGGTGG - Intergenic
1066224666 10:33370523-33370545 CAGGCTGCTTCCACTCATGGCGG + Intergenic
1066473935 10:35726063-35726085 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1066676173 10:37889829-37889851 CAGGAAACTTACACTCATAGTGG + Intergenic
1067084847 10:43232364-43232386 CAGGGAGCTTTCACTCATAGTGG - Intronic
1067151871 10:43742556-43742578 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1067179113 10:43971704-43971726 CAGGGAACTTCCATTCATGGAGG + Intergenic
1067518169 10:46973160-46973182 TGGGCTGCTTCCACTCATGGTGG + Intronic
1067559078 10:47292034-47292056 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1067569545 10:47361350-47361372 CAGGCCACTTCCCTTCAGAGAGG - Intergenic
1067644080 10:48078668-48078690 TGGGCTGCTTCCACTCATGGTGG - Intergenic
1067810893 10:49426307-49426329 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1068100586 10:52547677-52547699 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1068297991 10:55100547-55100569 CAGGCTGCTTCCACTCATGTTGG + Intronic
1068345244 10:55769437-55769459 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1068521901 10:58085988-58086010 CAGGAAACTTCCACTCATGGTGG - Intergenic
1068712260 10:60147759-60147781 CAGGAAACTTACAATCATAGGGG - Intronic
1068757841 10:60674367-60674389 CAGGAAGCTTCCACTCATGGTGG + Intronic
1068887682 10:62114475-62114497 CAGGCTGCTTCAACTTATGGTGG + Intergenic
1069646349 10:70001308-70001330 TAGGCCACACCCACTCATAGTGG - Intergenic
1070052728 10:72904936-72904958 CAGGCTGCTCCCACTCATGGAGG + Intronic
1070419896 10:76226185-76226207 CAGGAAACTTACAGTCATAGTGG + Intronic
1070419978 10:76226772-76226794 CAGGCTGATTCCACTCATGGAGG - Intronic
1070580760 10:77717370-77717392 CAGGCTGCTTCCACCCATGGTGG - Intergenic
1070861319 10:79665496-79665518 CAGCATTCTTCCACTCAAAGAGG - Intergenic
1070875930 10:79810103-79810125 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1071129187 10:82371736-82371758 CAGGGTGCTTCCACTCCTGGAGG + Intronic
1071344056 10:84674585-84674607 CAGGCTGCTTCTACTCACGGTGG + Intergenic
1071380279 10:85052587-85052609 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1071396139 10:85225901-85225923 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1071642863 10:87332236-87332258 CAGCATTCTTCCACTCAAAGAGG + Intergenic
1071718752 10:88122186-88122208 CAGGAAACTTACAATCATAGTGG + Intergenic
1071752989 10:88502502-88502524 CATGCTACTTCCACTCAAGGTGG - Intronic
1071868694 10:89767395-89767417 GAGGCTACCTCCACACATAGTGG - Intronic
1071934388 10:90511330-90511352 CAGGCTGCTTCCTCTCATGATGG + Intergenic
1072477108 10:95772998-95773020 CAGGCTGCTTCCACTCTTGGAGG + Intronic
1072796234 10:98356939-98356961 CAGGCAACTTACAATCATGGGGG + Intergenic
1072833251 10:98682270-98682292 CAGGGAACTTTCACTCATGGTGG - Intronic
1073502134 10:103949853-103949875 CAGGCTTCTTCCACTCACAGTGG + Intergenic
1073676662 10:105655004-105655026 CAGGAAACTTCCAATCATGGTGG - Intergenic
1073732831 10:106310872-106310894 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1073761734 10:106636514-106636536 CAGGAAACTTACAATCATAGTGG + Intronic
1073833709 10:107416438-107416460 CAGGAAGCTTCCACTCATATAGG + Intergenic
1073873537 10:107894658-107894680 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
1073924462 10:108499084-108499106 CAGGCTGCTTCTACTCACAGAGG + Intergenic
1074197880 10:111205310-111205332 CTGGCTGCTTCCACTCATGATGG - Intergenic
1074264286 10:111885902-111885924 CAGGATGCTTCAACTCATGGTGG + Intergenic
1075009845 10:118858161-118858183 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1075077438 10:119360543-119360565 CAGGCTCCTTCCACTCACACAGG - Intronic
1076932770 10:133544650-133544672 CAGGCTGCTTCCACATATAGTGG + Intronic
1077378879 11:2218741-2218763 CAGCCTGCATCCACTCATGGCGG + Intergenic
1077379186 11:2220724-2220746 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1077399730 11:2348297-2348319 CAGGAAACTTCCAATCATGGTGG - Intergenic
1078195821 11:9135862-9135884 CAAGCTGCTTCCACACATGGTGG - Intronic
1078415922 11:11164791-11164813 CAGGCTGCTTCCACTCGTGATGG + Intergenic
1078443245 11:11385049-11385071 CAGGCTGCTTCCACTCATGGTGG + Intronic
1079818696 11:25095547-25095569 CAGGAAACTTACAATCATAGTGG - Intergenic
1080053723 11:27883806-27883828 CAGGAAACTTACACTCATGGTGG + Intergenic
1080184022 11:29457697-29457719 CAGGAAACTTACACTCATGGCGG - Intergenic
1080209109 11:29765046-29765068 CATGCTGCTTCCACTCAAGGCGG - Intergenic
1080318162 11:30973361-30973383 CAGGAAACTTACAGTCATAGTGG - Intronic
1080392681 11:31862876-31862898 CAGGAAACTTACAATCATAGTGG - Intronic
1080440396 11:32288966-32288988 CAGGGTGCTTCCACTCATGGTGG - Intergenic
1080611236 11:33905870-33905892 CAGGAAACTTACAATCATAGTGG - Intergenic
1080720676 11:34845359-34845381 CAGGATGCTTCCATTCATAGTGG - Intergenic
1080964083 11:37194439-37194461 CAGGCTGCTTCCACTTCTGGTGG + Intergenic
1080970934 11:37275968-37275990 CAGGAAACTTACAATCATAGTGG - Intergenic
1080990411 11:37528422-37528444 CAGGAAACTTACAATCATAGTGG + Intergenic
1081132654 11:39399462-39399484 CAGGAAACTTACAATCATAGTGG + Intergenic
1081262099 11:40973077-40973099 CAGGAAACTTACAATCATAGTGG - Intronic
1081327543 11:41764159-41764181 TAGGCTGCTTCCACTCATGGCGG + Intergenic
1081335167 11:41856466-41856488 CAGGAAACTTCCACTCAGAGTGG - Intergenic
1081380465 11:42408316-42408338 AATGCTTCTTCCACTGATAGAGG - Intergenic
1081441329 11:43084890-43084912 CAGGGAACTTACAATCATAGTGG + Intergenic
1081661114 11:44889064-44889086 CAGGCAACTTACAATCATGGCGG - Intronic
1081744057 11:45460712-45460734 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1082822997 11:57557337-57557359 CAGGAAGCTTCCACTCATGGTGG - Intronic
1083086784 11:60156338-60156360 CAGGCTGCTTGCACTCATTGTGG - Intergenic
1083255510 11:61493084-61493106 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1084682426 11:70674160-70674182 CAGGAAGCTTCCACTCATGGCGG - Intronic
1084976980 11:72806572-72806594 CAGGCTGCTTCCACTCACTGTGG + Intergenic
1085147107 11:74210692-74210714 CAGGCTGCTTCCACTCATGGTGG - Intronic
1085506131 11:77060776-77060798 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1085544895 11:77309235-77309257 CAGGCTGCCTCCACTCACAGTGG + Intergenic
1085806881 11:79644564-79644586 CAGGATACTTACAATCATGGCGG + Intergenic
1086448442 11:86891898-86891920 CAGGAAACTTCCAGTCATGGTGG - Intronic
1086495946 11:87404618-87404640 CAGGCTGCTTCTACTTATGGTGG + Intergenic
1086537727 11:87868343-87868365 CAGGCTGCTTCCACTCATGCTGG - Intergenic
1086869476 11:92019051-92019073 CAGGACACTTCCAATCATGGTGG + Intergenic
1086874915 11:92083993-92084015 CAGGCTGCTTCCATTCCTAGCGG - Intergenic
1087334815 11:96830216-96830238 CAGGCTGCTTCCACTCATGGAGG - Intergenic
1087482571 11:98719815-98719837 CAGGAAACTTACAATCATAGTGG + Intergenic
1087492438 11:98845387-98845409 CAGAGTACTTTCACTCATGGTGG + Intergenic
1088679607 11:112227576-112227598 CAGGGACCTTCCACTCATGGTGG + Intronic
1088740293 11:112761776-112761798 CGGGAAACTTCCACTCATGGCGG + Intergenic
1088879411 11:113961888-113961910 CAGGAAACTTCCACTGATGGTGG + Intergenic
1088968054 11:114745286-114745308 CAGACTCCTTCCACTCAGGGTGG + Intergenic
1089925756 11:122255736-122255758 CATGCTTCTTCAACTCATGGTGG - Intergenic
1090039501 11:123277858-123277880 CAGGGAGCTTCCACTCATGGTGG + Intergenic
1090040771 11:123289470-123289492 CAGGCTGCTTCCAGTCATGGCGG + Intergenic
1090040791 11:123289568-123289590 CAAGCTGCTTCCAGTCATGGCGG + Intergenic
1090822695 11:130357879-130357901 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1091091637 11:132776629-132776651 CAGGGAGCTTCCACTCATGGTGG - Intronic
1091385823 12:93932-93954 CAGGCTGCTTCCATTCATAGTGG - Intronic
1091580064 12:1780595-1780617 CAGTCTACTGCCACTCAGAGGGG + Exonic
1091772519 12:3162224-3162246 CAGGCTGCTTCTGCTCATGGTGG - Intronic
1091910706 12:4228318-4228340 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1092149009 12:6234148-6234170 CAGGGGACTTCCAGTCAAAGGGG + Intronic
1092327670 12:7550614-7550636 CAAGCTACTTCTGCTCATGGGGG - Intergenic
1092602157 12:10078941-10078963 CAGGCAGCTTCCACACATGGGGG - Intronic
1092735291 12:11576741-11576763 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1092751767 12:11725844-11725866 CAGGCTGCTTCCACTCGTGGCGG - Intronic
1092962108 12:13606294-13606316 CAGGCTGCTTCCACTCATGGTGG + Intronic
1092976182 12:13746886-13746908 CAGGAAACTTCCACTCATGGTGG - Intronic
1093191281 12:16077886-16077908 CAGGCTTCTTCCACTCATGGTGG - Intergenic
1093656944 12:21705825-21705847 CAGGCTGCTTCCACTCGTGGTGG - Intronic
1093713331 12:22352971-22352993 GAGGCTGCTTCCACTCAAGGTGG - Intronic
1093732225 12:22578342-22578364 CAGGCTACTTCCATTCATGGCGG + Intergenic
1093783259 12:23161835-23161857 CAGACTGCTTCCACTCCTGGTGG + Intergenic
1094030516 12:26006996-26007018 CAGGCTGCTTCCACTCATGGTGG + Intronic
1094156932 12:27347017-27347039 CAGGCTGCATCCACTCAAGGTGG - Intronic
1094360948 12:29630275-29630297 CAGGAAACTTACAATCATAGTGG + Intronic
1094717245 12:33024731-33024753 CAGGAAACTTCCAATCACAGTGG - Intergenic
1095304708 12:40625978-40626000 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1095317621 12:40785319-40785341 CAGGGAGCTTTCACTCATAGTGG + Intronic
1095433240 12:42157188-42157210 CATGCTGCTTCAACTCATGGTGG + Exonic
1095530460 12:43181356-43181378 CAGGTAACTTACAATCATAGTGG + Intergenic
1095728906 12:45483566-45483588 CATGCTGCTTTCACTCATGGTGG + Intergenic
1095837016 12:46649701-46649723 CAGGCTGCTCACACTCATGGTGG - Intergenic
1095934180 12:47658773-47658795 CAGGCCACTTCCACCCTGAGAGG + Intergenic
1096065846 12:48739589-48739611 CAGGAAACTTACACTCATGGTGG + Intergenic
1096236774 12:49933846-49933868 CAGCCCACTTCCATTCATGGGGG + Intergenic
1096905948 12:54935667-54935689 CAGGCTGCTTGCAGTCATGGTGG + Intergenic
1097364498 12:58696282-58696304 CAGGAAACTTGCAATCATAGTGG - Intronic
1097708764 12:62895792-62895814 CAGGCTGCTTCCACTCATGGTGG - Intronic
1097881144 12:64687697-64687719 CAGGCTATTTTCATTCCTAGTGG - Intronic
1098120955 12:67237468-67237490 CAGGCTATTTCTACTCGTGGTGG - Intergenic
1098761192 12:74427415-74427437 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1098961693 12:76745724-76745746 CAGGTTGCTTTCACTCATGGTGG - Intergenic
1099214467 12:79837808-79837830 CAGGAAACTTACAATCATAGTGG - Intronic
1099862357 12:88235649-88235671 CAGGAAACTTACAGTCATAGTGG + Intergenic
1099963426 12:89418760-89418782 CAAGCTGCTTTCACTCATGGTGG - Intergenic
1100084103 12:90886481-90886503 CAGGAAACTTGCAATCATAGTGG - Intergenic
1100133809 12:91528904-91528926 CAGGAAACTTACAGTCATAGTGG - Intergenic
1100192911 12:92212003-92212025 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1100286640 12:93173181-93173203 TAGGCTGCTTCCACTCATGGTGG + Intergenic
1100368836 12:93946586-93946608 CAGGCTGCTTCAACTCATGGTGG + Intergenic
1100380720 12:94059245-94059267 CAGACTGCTTCCACTCATGGTGG - Intergenic
1100732703 12:97490208-97490230 CATGTTAATTCCACTCATATAGG + Intergenic
1100795499 12:98177440-98177462 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
1100849665 12:98696239-98696261 TCGGCTGCTTCCACTCATGGTGG + Intronic
1102184429 12:110936637-110936659 CAGGAAACTTACACTCATGGCGG - Intergenic
1102741372 12:115210423-115210445 CAGGAAACTTACAATCATAGCGG - Intergenic
1103023292 12:117553923-117553945 CAGGCTGCTTCCACTCATGTTGG - Intronic
1103164088 12:118755352-118755374 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1103895223 12:124268783-124268805 CAGGATACTTACAATCATGGCGG + Intronic
1104100938 12:125608983-125609005 CAGGCAACTTACAATCATGGTGG + Intronic
1104140026 12:125979064-125979086 CAGGCTGCTTCTATTCATGGGGG + Intergenic
1104205921 12:126638369-126638391 CAGGACACTTCCAATCATGGTGG + Intergenic
1104385929 12:128351601-128351623 CAGGCTGCTTCCACTCATGGTGG + Intronic
1104470661 12:129026960-129026982 CAGGAAACTTACACTCATGGCGG - Intergenic
1104795652 12:131515457-131515479 CAGGCTACTTGAAATTATAGAGG + Intergenic
1105901470 13:24758052-24758074 CAGGCAACTTACAATCATGGTGG - Intergenic
1106095403 13:26639000-26639022 CAGGCTGCTTCCACTCATGGTGG - Intronic
1106130706 13:26937100-26937122 CAGGATGCTTCCACTCATGGTGG - Intergenic
1106360904 13:29029694-29029716 CAGGCTGCTTCCACTCAAGGGGG + Intronic
1106366428 13:29085148-29085170 CAGGAAGCTTCCACTCATGGTGG - Intronic
1106653847 13:31721104-31721126 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1106662009 13:31809594-31809616 CAGTCTGCTTCCAGTCATTGTGG - Intergenic
1106667760 13:31870553-31870575 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1106714650 13:32374984-32375006 CAGGAAACTTACAATCATAGTGG + Intronic
1106856941 13:33864054-33864076 CAGGAAGCTTCCACTCATGGTGG + Intronic
1107034199 13:35883455-35883477 CAAGCTACTTCCACTCATGGTGG - Intronic
1107042604 13:35965729-35965751 CAGACCCCTTCCACTCTTAGGGG + Intronic
1107105494 13:36638168-36638190 CAGGATACTTACAGTCATGGTGG + Intergenic
1108027717 13:46195883-46195905 CAGGCTGCTTTCACTCATGGCGG - Intronic
1108041188 13:46340676-46340698 GTGGCTGCTTCCACTCATGGTGG + Intergenic
1108083286 13:46759445-46759467 CAAGCTGCTTCCACTTATGGTGG - Intergenic
1108190019 13:47928823-47928845 CAGACTGCTTCCACTCATGCTGG + Intergenic
1108527918 13:51301512-51301534 CAGGAAACTTCCACTCATGATGG + Intergenic
1108855758 13:54790967-54790989 CAAGTTTCTTCCACTTATAGCGG + Intergenic
1108925983 13:55745574-55745596 CAGGAAACTTACAATCATAGTGG - Intergenic
1109050308 13:57472407-57472429 CAGTCTGCTTCCATTCATGGTGG + Intergenic
1109132199 13:58601589-58601611 CAGGCAACTTACAATCATGGTGG + Intergenic
1109371620 13:61428284-61428306 CAGGCTGCTTCCACCTATGGTGG + Intergenic
1109371670 13:61428737-61428759 CAGGTTACTTCCACTCCCGGTGG - Intergenic
1109819730 13:67637567-67637589 TGGACTACCTCCACTCATAGTGG - Intergenic
1109819951 13:67639565-67639587 CAGGCTGCTTTCACTCATGGTGG - Intergenic
1109977223 13:69854270-69854292 CAGGCTGTTTCTACTCATTGAGG + Intronic
1110002994 13:70229419-70229441 CAAGCTGCTTCCACTCATGGTGG - Intergenic
1110027569 13:70560498-70560520 CATGCTGCTTGCACTCATGGTGG - Intergenic
1110079810 13:71295901-71295923 CAGGAAACTTACAATCATAGTGG + Intergenic
1110182662 13:72635945-72635967 CAGGCTGCCTCTACTCATGGTGG - Intergenic
1110550076 13:76802198-76802220 CAGGAAACTTACAATCATAGTGG + Intergenic
1110924100 13:81128706-81128728 CAGGCTGTTTCCGCTCATGGTGG - Intergenic
1111099460 13:83563721-83563743 CAGGCTACTTCCATTCACTGCGG - Intergenic
1111228471 13:85308019-85308041 CAGTAAACTTACACTCATAGTGG - Intergenic
1111574034 13:90127052-90127074 CAGGCTTCTTCCCTCCATAGTGG - Intergenic
1111668301 13:91297037-91297059 CAGTCTCCTTCCACTCATGGTGG - Intergenic
1112288256 13:98123059-98123081 CAGGCTGCTTCCACTCACAGTGG - Intergenic
1112361770 13:98725149-98725171 CAGGCTGCTTCCATTCATGGAGG - Intronic
1112515407 13:100048987-100049009 CAGGAAACTTTCACTCATGGAGG + Intergenic
1112586643 13:100724157-100724179 CAGGCTGCTTCCACTTATAATGG - Intergenic
1112623782 13:101079065-101079087 CAGGCAACTTACAATCATGGTGG - Intronic
1112782882 13:102921065-102921087 CAGGCTTCTTCCACTTAGTGAGG + Intergenic
1112932903 13:104763581-104763603 CAGGAAACTTCCAATCATGGGGG - Intergenic
1113050455 13:106205825-106205847 CAGGCTGCTTCCACTCATGGAGG + Intergenic
1113818077 13:113189204-113189226 CAGGCTGCTTCCACTCATGCTGG - Intronic
1114248729 14:20938516-20938538 CAGGAAACTTCCAATCATAGTGG - Intergenic
1114378616 14:22176440-22176462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1114764233 14:25352059-25352081 TAGGCTGCTTCTACTCATGGTGG + Intergenic
1115006895 14:28496672-28496694 CAGGAAACTTTCAATCATAGTGG - Intergenic
1115137917 14:30133191-30133213 CAAGCTGCTTCCACTCATAGTGG - Intronic
1115282721 14:31682917-31682939 CAGGCTGCTCCCACTCATGGTGG + Intronic
1115528666 14:34305903-34305925 CAGGAAACTTCCAATCATGGCGG - Intronic
1115765054 14:36614647-36614669 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
1115953123 14:38744324-38744346 CAGGAAACTTACAATCATAGTGG + Intergenic
1116444212 14:44989880-44989902 CAGGAAACTTACAATCATAGTGG + Intronic
1117301960 14:54438981-54439003 CAGCCTGCTTCCACTCATGGTGG - Intronic
1117761196 14:59030728-59030750 CAGGCTGTTTCTACTCATGGTGG - Intergenic
1117784669 14:59270302-59270324 CAGCCTGCTTCCACTCATGGTGG + Intronic
1117942718 14:60985824-60985846 CAGGCTGCTTTCATTCATTGTGG + Intronic
1118038073 14:61889713-61889735 CAGACTGCTTCCACTCAGAGTGG - Intergenic
1118151595 14:63195878-63195900 CAGGATACTTACAATCATGGTGG - Intergenic
1118233244 14:63974317-63974339 TAGGCTACTTCCATTCATAGTGG + Intronic
1118301615 14:64621768-64621790 CAGGAAACTTCCAATCATGGTGG - Intergenic
1119115321 14:72015153-72015175 CCAGCTGCTTCCACTCATGGAGG + Intronic
1119149002 14:72341180-72341202 CAGGAAACTTACAGTCATAGTGG + Intronic
1119178351 14:72586422-72586444 GAGGCTGCTTCCACCCATGGTGG - Intergenic
1119617590 14:76109037-76109059 CAGGCTGCTTCCACTCACGGCGG + Intergenic
1119957668 14:78817602-78817624 CATGCTGCTTCCACTCATGGAGG + Intronic
1120073762 14:80132903-80132925 CAGGCTGGTTCCACTCATGGTGG - Intergenic
1120179470 14:81328876-81328898 CAGGCTGCTTCCACTCATGGTGG - Intronic
1120263016 14:82212428-82212450 CAGGCTGTTTCCACTCATGGTGG - Intergenic
1120623159 14:86791178-86791200 CAGGAAACTTCCAATCATGGTGG - Intergenic
1120733712 14:88030361-88030383 CAGGCTACTTCCACTCATGGTGG - Intergenic
1120819592 14:88899858-88899880 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1121210408 14:92204115-92204137 CAGGCTGCTTCTACTCATGGTGG - Intergenic
1121215399 14:92243940-92243962 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1121240463 14:92426272-92426294 CAGGCTGCTTTCACTCACGGTGG + Intronic
1121372789 14:93375619-93375641 CAGGAAACTTCCAGTCATGGTGG + Intronic
1121530354 14:94648463-94648485 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1121924381 14:97914604-97914626 CAGGGTGCTTCCACACAGAGAGG - Intergenic
1121989160 14:98538385-98538407 CAAAATACTTCAACTCATAGTGG + Intergenic
1122182040 14:99962373-99962395 CAGGCTGCTTGCATTCATGGTGG - Intergenic
1122352876 14:101106934-101106956 CAGGAAACTTACAATCATAGTGG + Intergenic
1122525925 14:102384331-102384353 CATGCTGCTTCCACTCATGGTGG + Intronic
1122553830 14:102565600-102565622 CAGGAAACTTACAGTCATAGTGG - Intergenic
1122562982 14:102630299-102630321 CAGGCTGCTTCCACACATGGCGG - Intronic
1122831468 14:104399257-104399279 CAGGTTGCTTCCACTCATGATGG - Intergenic
1123794263 15:23755876-23755898 GAGGCTGCTTCCATTCATGGTGG + Intergenic
1124073312 15:26415749-26415771 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1124117088 15:26854718-26854740 CAGGCTGCTTCCACTCAAGGTGG - Intronic
1124227894 15:27911520-27911542 CCGGCTGCTTCCCCTCATAGTGG + Intronic
1124478054 15:30053032-30053054 CAGGACACTTACAATCATAGTGG + Intergenic
1124601428 15:31135816-31135838 CAGGCTGCCTCCACTCATGGTGG - Intronic
1124601957 15:31140644-31140666 CAGCCTGCTTCCATTCATGGAGG - Intronic
1124608304 15:31188725-31188747 CAGGAAACTTTCACTCATGGTGG - Intergenic
1124793701 15:32754494-32754516 CAGGCTGTTTCCACTTATGGTGG - Intergenic
1125093989 15:35829871-35829893 CAGGGTGCTTCCACTCTTGGTGG + Intergenic
1125423843 15:39530570-39530592 CAGGCTGCTTCCACTTGTGGTGG + Intergenic
1125780079 15:42257407-42257429 CAGGCTGTTTCTACTCATGGTGG - Intronic
1125881144 15:43197087-43197109 CAGGCTGCTTCCACTTATGCAGG - Exonic
1125969150 15:43897965-43897987 CAGGAAACTTACAATCATAGCGG - Intronic
1126389518 15:48131586-48131608 CAGGCTGCTTCCACTCATGGTGG - Intronic
1126441773 15:48697324-48697346 CAGGCAACTTACAATCATGGTGG - Intergenic
1126815202 15:52447344-52447366 CAGGAAGCTTCCACTCATGGTGG - Intronic
1127052156 15:55095821-55095843 CAGGTTGCTTCCACTCATGGTGG + Intergenic
1127178781 15:56392311-56392333 CAGGAAACTTCCAATCATGGCGG + Intronic
1127404773 15:58631119-58631141 CAGGCTGCTTCCACTTATGATGG - Intronic
1127542157 15:59951454-59951476 CAGGCTACTTCCACTCATGATGG - Intergenic
1127848615 15:62893931-62893953 CAGGAAACTTACAATCATAGTGG + Intergenic
1128301925 15:66571330-66571352 CAGGAAACTTACAATCATAGTGG - Intergenic
1129345048 15:74912141-74912163 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1129958244 15:79659000-79659022 CAGGCTGCTTCCTCTCATGGAGG + Intergenic
1130038027 15:80379195-80379217 CAGGCTGCTTCCACTCATGGTGG - Exonic
1130349117 15:83075004-83075026 CAGGCTGCTTCTACTCATGGTGG + Intergenic
1130562747 15:84971534-84971556 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
1130812435 15:87393980-87394002 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1130815766 15:87430726-87430748 CCAGCTGCTTCCACTCATGGTGG - Intergenic
1130978582 15:88796223-88796245 CAGGAAACTTACAGTCATAGTGG + Intergenic
1131350801 15:91698101-91698123 CAGGAAACTTACACTCATGGTGG - Intergenic
1131428032 15:92362994-92363016 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1131628001 15:94144659-94144681 CAGGCCCCTTCCACTCAGGGTGG - Intergenic
1131924713 15:97369639-97369661 CAGGAAACTTACAATCATAGCGG - Intergenic
1133256519 16:4519844-4519866 CAGGCTGCTTCCATTCATGGTGG - Intronic
1133450071 16:5896503-5896525 CAGGCTGCTTCCACTCATGTTGG - Intergenic
1133453758 16:5924577-5924599 CAGGCTACTTCTACTTATGGTGG - Intergenic
1133703782 16:8333982-8334004 CAGGCAACTTACAATCATGGTGG - Intergenic
1133721962 16:8502895-8502917 CAGGAAACTTACAATCATAGTGG - Intergenic
1133753534 16:8744276-8744298 CAGGAAACTTCCAATCATGGTGG + Intronic
1133813570 16:9179594-9179616 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1133837649 16:9381020-9381042 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1133865294 16:9636647-9636669 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1133927870 16:10207929-10207951 CAGGCTGCTTCCAATCATGGTGG - Intergenic
1134432841 16:14227389-14227411 CAGGCTGCTTCCACTCATGGTGG - Intronic
1134560278 16:15203119-15203141 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1134768282 16:16781559-16781581 CAGGAAACTTCCAATCATGGCGG - Intergenic
1134773200 16:16828899-16828921 CAGACTGCTTCAACTCATGGTGG + Intergenic
1134920820 16:18114733-18114755 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1135020774 16:18961245-18961267 CAGGCTTCTTCTACTCATGGTGG + Intergenic
1135380582 16:21993043-21993065 CAGGAAACTTACAATCATAGTGG - Intronic
1135397498 16:22142348-22142370 CAGGCTGCTTCCACTCATGGTGG + Intronic
1135673792 16:24396987-24397009 CAGGCTGTTTCTACTCCTAGTGG + Intergenic
1135678543 16:24437818-24437840 CAGGCTACTTCCACTCATGGTGG - Intergenic
1135680963 16:24456248-24456270 CAGGAAACTTACAATCATAGGGG - Intergenic
1135805147 16:25535906-25535928 CAGTCCTCTTCCACTCATGGTGG - Intergenic
1135885027 16:26297948-26297970 CATGCTTCTTCCACTCTTGGCGG + Intergenic
1135937532 16:26793734-26793756 CAGGCCGCTTCCACTCATGGCGG - Intergenic
1136093387 16:27936517-27936539 CAGGCTGCTTCCACTCATGGAGG - Intronic
1136127748 16:28196852-28196874 CAGGCTACTTCCACTCCTGGTGG - Intronic
1136528240 16:30847337-30847359 CAGGCTACTTCCACTCACAAGGG - Intronic
1137578337 16:49618579-49618601 CAGGAAACTTACAATCATAGTGG - Intronic
1138073205 16:54014455-54014477 CAGGAAGCTTCCACTCATGGTGG - Intronic
1138088580 16:54155733-54155755 CAGGAAACTTCCAATCATAGGGG + Intergenic
1138499111 16:57427668-57427690 CAGGCAACTTACAATCATGGCGG - Intergenic
1139163101 16:64535030-64535052 CAGGCAACTTACAGTCATGGTGG - Intergenic
1139196831 16:64929542-64929564 CAGGAAACTTACAATCATAGTGG + Intergenic
1139290281 16:65852110-65852132 CAGGAAACTTACAATCATAGCGG + Intergenic
1140051727 16:71487358-71487380 CAGGATACTTACAATCATGGTGG - Intronic
1140608570 16:76570612-76570634 CAGGAAACTTCCAATCATTGCGG - Intronic
1140687992 16:77451947-77451969 CAGCCTGTTTCCACTCATGGTGG - Intergenic
1140704595 16:77614978-77615000 CAAGCTACTTCCACTTATGGTGG + Intergenic
1140818913 16:78645536-78645558 CAGGCAGCTTCTACTCATGGTGG + Intronic
1141001399 16:80311667-80311689 CAGGCTGCTTCCGCTCGTGGTGG - Intergenic
1141236539 16:82222944-82222966 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1141718687 16:85742461-85742483 CAGGCTGCTTCCACTCAAGGCGG - Intronic
1143439280 17:6955924-6955946 CAGGCTGCTTCTACTAATGGTGG - Intronic
1143662931 17:8338233-8338255 CAGGCTGCTTTCACTTATGGTGG + Intergenic
1143725464 17:8842086-8842108 CAGGAAACTTCCACTCCTGGTGG - Intronic
1144012161 17:11159440-11159462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1144599294 17:16598644-16598666 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1145290667 17:21543147-21543169 CAGGCTGCCTCCAGTCATGGTGG + Intronic
1148977649 17:51543741-51543763 TAGGCTACTTCCAGCCATAAAGG - Intergenic
1149122837 17:53190789-53190811 CAGGAAACTTACAATCATAGTGG + Intergenic
1149383342 17:56116624-56116646 CAGGGTACTTCATCTCATGGTGG - Intronic
1150497980 17:65623747-65623769 CAGGATACTTCCAATCATGGTGG - Intronic
1150732158 17:67705068-67705090 CAGGCTGCTTCCACTCACGGTGG + Intergenic
1150962748 17:69932693-69932715 CAGGAAACTTACAATCATAGTGG - Intergenic
1151123351 17:71817760-71817782 CAGGCTGCTTCCACTCATGGAGG - Intergenic
1151148831 17:72066203-72066225 CAGGAAACTTACAATCATAGTGG + Intergenic
1151362344 17:73596250-73596272 CAGGCTGCCTTCTCTCATAGAGG - Intronic
1151386890 17:73760431-73760453 GAGGCTGCTTCCACTTACAGAGG + Intergenic
1152292484 17:79448041-79448063 CAGGAAACTTCCAATCATGGCGG - Intronic
1152300550 17:79493098-79493120 CAGGAAGCTTCCACTCATGGTGG + Intronic
1153206817 18:2711988-2712010 CAGGCTGCTTCCACTCATGGTGG - Intronic
1153841572 18:9012730-9012752 CAGGCTGCTTCCACACATGGTGG + Intergenic
1153951993 18:10065225-10065247 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1154003938 18:10509831-10509853 CAGGCTGCTTCTACTTATGGTGG - Intergenic
1154366705 18:13716795-13716817 CAGGAAACTTCCAATCATAGTGG - Intronic
1154371216 18:13764949-13764971 CAGGCTGCCTCCACTCATGGTGG - Intergenic
1154949021 18:21190317-21190339 CAGGAAACTTCCAATCATGGTGG - Intergenic
1155313742 18:24550392-24550414 CAGGCTGCTTCAACTCATGGTGG - Intergenic
1155416905 18:25608059-25608081 CAGGGTACTGCTGCTCATAGTGG + Intergenic
1155442387 18:25875839-25875861 CAGGCTGCTTCCACTCACGGGGG - Intergenic
1155735362 18:29215977-29215999 CAGGCTGCTTCTATTCATGGTGG + Intergenic
1155848691 18:30743266-30743288 CAGGCTGCTTCTTCTCATGGAGG + Intergenic
1156078309 18:33306970-33306992 CAGGAAACTTACAATCATAGTGG - Intronic
1156806857 18:41194554-41194576 CATGCTGTTTCCACTCATGGTGG - Intergenic
1157183019 18:45514232-45514254 CAGGAAACTTACAATCATAGTGG + Intronic
1157488193 18:48104357-48104379 CAGGAAACTTCCACTCATGGTGG - Intronic
1157718277 18:49904337-49904359 CAGGCTGCTTCCACTCATGGTGG - Intronic
1157768108 18:50318094-50318116 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1157904673 18:51558974-51558996 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1157908361 18:51590948-51590970 CAGACTGCTTCCACTCATGGTGG + Intergenic
1157989064 18:52473523-52473545 CAGGAAACTTACAATCATAGTGG + Intronic
1158143257 18:54280253-54280275 CAGGCTGTTTCCACTCATGGTGG + Intronic
1158839143 18:61364729-61364751 CAGGCTGCTTCCATTCATTGTGG - Intronic
1159008028 18:63030892-63030914 CAGGAAACTTACAATCATAGTGG - Intergenic
1159262026 18:66026452-66026474 CAGGCTGTTTCTACTCATGGTGG - Intergenic
1159399443 18:67911616-67911638 CAGGATTCTTCCACTCACCGTGG - Intergenic
1159697143 18:71574670-71574692 CAGGAAACTTACAATCATAGTGG + Intergenic
1159765444 18:72482634-72482656 CAGGAAACTTACAATCATAGTGG + Intergenic
1159814506 18:73056082-73056104 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1160144676 18:76353718-76353740 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1160629957 18:80239935-80239957 CTGGCTGCTTCTACTCACAGTGG + Intronic
1161074252 19:2277425-2277447 CAGGAAGCTTCCAATCATAGTGG - Intronic
1162137989 19:8567919-8567941 CAGGCCACTTCCCCTCACTGGGG + Intronic
1162868425 19:13566811-13566833 CAGGCTGCTTCTACTCATAGTGG - Intronic
1163086608 19:14985529-14985551 CAGGCAGCTTCCAGTCATGGTGG - Intronic
1163318509 19:16557692-16557714 CAGGCTGCTTTCACTCAGTGTGG + Intronic
1163478634 19:17541363-17541385 CAGGCTACTGCAAGACATAGAGG - Intronic
1164475955 19:28576186-28576208 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1164871426 19:31647524-31647546 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1164921294 19:32090478-32090500 CAGGAAACTTCCAATCATGGGGG - Intergenic
1165181284 19:33973117-33973139 CAGGCTGCTTGCACTTGTAGTGG - Intergenic
1165661096 19:37580766-37580788 CAGGCTGCTTCCATTCATGATGG - Intronic
1166441537 19:42819578-42819600 CAGGGAGCTTCCACTCATGGTGG - Intronic
1166449670 19:42887567-42887589 CAGGGAGCTTCCACTCATGGTGG - Intronic
1166478259 19:43147852-43147874 CAGGGAGCTTCCACTCATGGTGG - Intronic
1166515437 19:43443377-43443399 CAGGAAACTTACACTCATGGCGG + Intergenic
1167214920 19:48158081-48158103 CAGGATGCTTCCAGTCATGGTGG - Intronic
1167712180 19:51119155-51119177 CAGGCTGCTTCCAATCCTAGTGG + Intergenic
1167714436 19:51132224-51132246 CAGGAAGCTTCCACTCATGGTGG - Intronic
1167964734 19:53133949-53133971 CAGGAAACTTACAATCATAGAGG - Intronic
925047839 2:788166-788188 CAGGAAACTTACAATCATAGTGG + Intergenic
925096890 2:1212328-1212350 CAGGAAACTTCCAATCATGGTGG - Intronic
925291817 2:2752861-2752883 CAGGAAACTTCCAATCATGGTGG - Intergenic
925312050 2:2891685-2891707 CAGACAACTTCCAATCATGGTGG + Intergenic
925370305 2:3340036-3340058 CAGGAAACTTCCAATCATGGCGG - Intronic
925923231 2:8652165-8652187 CAGGCTGCTTCCCCTCATGGCGG + Intergenic
926058137 2:9788420-9788442 CAGGAAGCTTCCAGTCATAGTGG - Intergenic
926381933 2:12299678-12299700 CAGGCTGTTTCCACTCATGGTGG + Intergenic
926449346 2:12983363-12983385 CAGGAAACTTACAATCATAGTGG - Intergenic
926924773 2:17976436-17976458 CAGGAAGCTTCCACTCATGGGGG + Intronic
926962724 2:18376491-18376513 CAGGCCACTTCTAATGATAGAGG + Intergenic
927063047 2:19442245-19442267 CAAGCTTCCTCCACTCCTAGTGG + Intergenic
927300427 2:21505989-21506011 CAGGTTACTTCCACTCATGGTGG - Intergenic
927332224 2:21878861-21878883 CAGGCTACTTGTACTCATGATGG + Intergenic
927396345 2:22655477-22655499 CAGGAAACTTACAATCATAGTGG - Intergenic
927514749 2:23665657-23665679 CAGGCAGCTTCCACTCATGGTGG + Intronic
927715647 2:25350466-25350488 CAGGAAACTTCCACTCGTGGCGG - Intergenic
927895843 2:26781288-26781310 CAGGAAACTTACAATCATAGTGG + Intronic
928592931 2:32835552-32835574 CAGGCTGCTTCTACTCATGATGG - Intergenic
928619110 2:33071029-33071051 CTGGCCACAGCCACTCATAGTGG + Intronic
928977660 2:37105500-37105522 CCGGCTGCTTCCACTCATGGTGG - Exonic
929025020 2:37592128-37592150 CAGGCTGCTTCCACTCATGATGG - Intergenic
929519455 2:42634400-42634422 CAGGCAACTTACAATCATGGTGG + Intronic
929804629 2:45134051-45134073 CTGGCTGCTTCCATTCATGGTGG + Intergenic
930162804 2:48175697-48175719 CAGGCTGCTTCTACTCATGGTGG + Intergenic
930453169 2:51570233-51570255 CAGGCTGCTTCCACTCATGGTGG - Intergenic
930653553 2:53986246-53986268 CAGGCTGTTTCCACTCATGGTGG - Intronic
930877218 2:56232604-56232626 CAGGAAACTTACAATCATAGTGG - Intronic
930966602 2:57336122-57336144 CAGGCTGCTTTCACTCTTGGTGG + Intergenic
931216572 2:60250586-60250608 CAGGAAACTTACAATCATAGCGG + Intergenic
931493956 2:62782560-62782582 CAGGAAACTTACAGTCATAGTGG + Intronic
931590226 2:63874861-63874883 CCGGAATCTTCCACTCATAGTGG - Intronic
931803118 2:65778126-65778148 CAGGCTGCTTCCACTCCTGCAGG + Intergenic
931952316 2:67379215-67379237 CATGCTTTTTCCACTCATGGTGG - Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932937403 2:76120939-76120961 CAGGAAACTTACACTCATGGAGG - Intergenic
932948938 2:76270316-76270338 CAACCTGCTTGCACTCATAGTGG - Intergenic
933164799 2:79064192-79064214 CAGGAAACTTACAATCATAGTGG - Intergenic
933165141 2:79067331-79067353 CAGAGAACTTCCACTCATGGAGG - Intergenic
933476559 2:82799039-82799061 CAGGAAACTTACAATCATAGGGG + Intergenic
933799110 2:85945690-85945712 CAGGCCACTTCCATTCATGGTGG + Intergenic
934865614 2:97807496-97807518 TAGGCTGCTTCCACTCATATTGG - Intronic
934936161 2:98467050-98467072 CAGGCTGCTTCTACTCGTGGTGG + Intronic
935079341 2:99777121-99777143 CTGGCTACTGCCACTCACAGCGG - Intronic
935164457 2:100558027-100558049 CAGGCTGCTTCCACTCATCGTGG + Intergenic
935264785 2:101384960-101384982 CAGACTGCTTCCACTCATGGTGG - Intronic
935368824 2:102323515-102323537 CAGGCTGCTTCCAATCCTGGTGG + Intronic
935822633 2:106909400-106909422 CAAGCTGCTTCCACTCATGGCGG - Intergenic
935870768 2:107446664-107446686 CAGGCTGCTTCCACTCATAGTGG + Intergenic
936611121 2:114003003-114003025 CAGGCTGCTTTCACTCATGGTGG + Intergenic
936723161 2:115278573-115278595 CAGGCTGCTTCTACTTATGGTGG + Intronic
936837075 2:116722017-116722039 CAGGAAACTTACAATCATAGTGG + Intergenic
936989274 2:118345368-118345390 CAGGCTGCTTCCACTCATGGCGG - Intergenic
937167171 2:119830822-119830844 CAGGAAACTTACAATCATAGTGG - Intronic
937272384 2:120661235-120661257 CAGGCTCTTTCCACACAGAGGGG - Intergenic
937327312 2:120998374-120998396 CAGGAAACTTACACTCATGGCGG - Intergenic
937802833 2:126100463-126100485 CTGGCTGCTTCCACTCATGGTGG - Intergenic
938113532 2:128587830-128587852 CAAGCTGTTTCCACTCATGGTGG + Intergenic
938152127 2:128896203-128896225 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
938864990 2:135409096-135409118 CAGGAAACTTACAATCATAGTGG + Intronic
939445279 2:142302149-142302171 CAGGCTTCTTTCACTCATGTTGG - Intergenic
939480184 2:142738679-142738701 CAGGAAACTTACACTCATGGTGG + Intergenic
939573979 2:143874128-143874150 CAGGCTGCTTGCACTCATGGTGG + Intergenic
939624445 2:144459865-144459887 CAGGCTTCATTCTCTCATAGAGG + Intronic
939667982 2:144974216-144974238 CAGGCAACTTACAATCATGGTGG + Intergenic
939713169 2:145549019-145549041 CATGCTCCTTCCACTCAATGTGG - Intergenic
940411992 2:153375915-153375937 CAGGTTGCTTCCACGCATGGAGG + Intergenic
940487490 2:154314581-154314603 CAGGCTGCTTCCACTCACGGTGG + Intronic
940757461 2:157699470-157699492 CAGGCTACGGCCACCAATAGTGG + Intergenic
940929516 2:159410541-159410563 CAGGGAACTTACACTCATGGTGG - Intronic
941197186 2:162467531-162467553 CAGGCTGCTTCCACTCATGGTGG - Intronic
941198902 2:162484870-162484892 CAGGCTGCTTCCACTCGTGATGG - Intronic
941260564 2:163291718-163291740 CAGGAAACTTACAATCATAGCGG - Intergenic
941289547 2:163658549-163658571 CAGGCTGCTTCCACTCATGGTGG + Intronic
941364100 2:164589471-164589493 CAGGCTGCTTCCACTAATGGTGG + Intronic
941589689 2:167404103-167404125 CAAGCTGCTTCCACTCATGGTGG + Intergenic
941694932 2:168541031-168541053 CAGGCTGCTTCCACTCATGATGG + Intronic
941953569 2:171181570-171181592 CAGGCTGCTTCCACCCATGGTGG + Intronic
942108580 2:172657927-172657949 CAGGCTGCTTCCACTCCTGGTGG + Intergenic
942720655 2:178948817-178948839 CAGGCTGCTTTCACCCATGGCGG - Intronic
942732253 2:179073356-179073378 CAGGAAACTTGCAATCATAGTGG - Intergenic
942736471 2:179119843-179119865 CAGGAAACTTCCACTCATGATGG - Intronic
942855892 2:180547115-180547137 CAGGCTGCTTCCACTCACGGTGG - Intergenic
942896108 2:181056425-181056447 CAGGCTGCTTCAACTCACAGTGG + Intronic
942903805 2:181156860-181156882 CAGGAAGCTTCCAATCATAGTGG + Intergenic
943152074 2:184126391-184126413 CAGGCTGCTTCCACTCATGGTGG + Intergenic
943203801 2:184864174-184864196 CAGGCTGCTTCCACTCATAATGG + Intronic
943232034 2:185265838-185265860 CAGGAAACTTACAATCATAGTGG + Intergenic
943387716 2:187223308-187223330 CAGGAAACTTACAATCATAGTGG - Intergenic
943986188 2:194622214-194622236 TAGGCTGCTTCCACTCTTGGTGG - Intergenic
944578283 2:201111083-201111105 CAGGTTGCTTCCACCCATGGTGG + Intergenic
944754332 2:202744257-202744279 CAGACTGCATCCACTCATGGCGG + Intronic
945125522 2:206505502-206505524 CAGGAAACTTACAGTCATAGCGG + Intronic
945145401 2:206733082-206733104 CAGGCAGCTTCTACTCATGGTGG + Intergenic
945507486 2:210659272-210659294 CAGGCTGCTTCCATTCATGGTGG + Intronic
945558283 2:211306127-211306149 CAGGCTGCTTCCAGTCTTGGTGG - Intergenic
946703248 2:222433317-222433339 CAGGCTCCCTCCACTGAGAGGGG - Intronic
946714435 2:222538687-222538709 CAGGAAACTTACAGTCATAGTGG + Intronic
946762216 2:223005797-223005819 CAGGAAACTTACACTCATGGTGG + Intergenic
946769652 2:223075785-223075807 CAGGAAACTTACAATCATAGTGG - Intronic
946881943 2:224185328-224185350 CAGGCTGCTTCAACTCACAGTGG + Intergenic
946932510 2:224684518-224684540 CAGGAAGTTTCCACTCATAGCGG - Intergenic
947128569 2:226897573-226897595 CAGGCTACTTCCACTCATGGTGG + Intronic
947280708 2:228450789-228450811 CAGGAAACTTACAATCATAGTGG - Intergenic
947443328 2:230142083-230142105 CAGGAAACTTACACTCATGGTGG - Intergenic
947776691 2:232717675-232717697 CAGGCTGCTTACACTCATAGTGG + Intronic
948223025 2:236288513-236288535 CAGGAAACTTACAATCATAGTGG + Intergenic
948543954 2:238712252-238712274 CAGGCTGCTTCCGCTCATGGTGG + Intergenic
948730820 2:239962743-239962765 CAGGAAGCTTCCAATCATAGTGG + Intronic
948799715 2:240426855-240426877 CAGGAAGCTTCCACTCATGGTGG + Intergenic
949060993 2:241957257-241957279 CAGGGAACTTCCAGTCATGGTGG + Intergenic
1169334310 20:4742741-4742763 CCGGCTGCTTCTACTCATGGTGG - Intergenic
1169399029 20:5264182-5264204 TAGGCTGCTTCCCCTCATGGTGG + Intergenic
1169751309 20:8997469-8997491 CAGGAAACTTTCACTCATGGTGG - Intergenic
1169754296 20:9026807-9026829 CAGGCTGTTTCCACTCTTGGTGG + Intergenic
1169830030 20:9814984-9815006 CAGGCAGCTTCCACTTATGGTGG + Intronic
1169954640 20:11087726-11087748 CAAGCTGCTTGCACTCATGGTGG + Intergenic
1170062194 20:12271025-12271047 CAGGCTGCTTCCACTAATGGTGG + Intergenic
1170805111 20:19622840-19622862 CAAGGAACTTCCACTCATGGAGG + Intronic
1170814074 20:19698036-19698058 CAGGAAACTTCCAGTCATGGTGG + Intronic
1170834513 20:19872204-19872226 CAGGCAACTTACAATCATAGTGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1170971459 20:21120879-21120901 CAGGAAACTTGCAATCATAGCGG + Intergenic
1171470217 20:25364395-25364417 CAGGTTGCTTCCACTCAGGGTGG + Intronic
1172226434 20:33308052-33308074 CAGGAAACTTCCAATCATAGCGG + Intronic
1172299060 20:33835798-33835820 CAGGCTGCATCCACTCATGGTGG + Intronic
1172988784 20:39016119-39016141 CAGCCTGCTTCCACTCAAGGTGG + Intronic
1173048870 20:39539798-39539820 CAAGCTGCTTCCACTCAAGGTGG - Intergenic
1173139378 20:40468769-40468791 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1173317547 20:41958665-41958687 CAGGCTGCTTCTACTCATGATGG - Intergenic
1173445041 20:43110128-43110150 CAGGCTGCTTCCACTCATGATGG + Intronic
1173493378 20:43501335-43501357 CAGGAAACTTACAATCATAGTGG - Intergenic
1173734823 20:45352476-45352498 CAGGAAACTTCCAATCATGGCGG - Intergenic
1173965340 20:47108382-47108404 CAGGCTGCTTCCACTCATGGTGG - Intronic
1173969495 20:47140857-47140879 CAAGCTGCTTCCATTCATGGTGG + Intronic
1174077274 20:47946565-47946587 CGAGCTGCTTCCACTCATGGTGG - Intergenic
1174123248 20:48283303-48283325 CAGGAAGCTTCCAATCATAGGGG + Intergenic
1174123489 20:48285574-48285596 CAGGCAGCTTCCACTCACGGGGG + Intergenic
1174311229 20:49656229-49656251 CAGGCTGCTTCCACTCTTGGTGG - Intronic
1174333928 20:49844012-49844034 TAGGCTGCTTCCACTCATGGGGG - Intronic
1174553884 20:51380499-51380521 CAAGCTGCTTCCGCTCATGGTGG + Intergenic
1174829314 20:53798047-53798069 CAGGTTGCTTCCACTCATGGCGG - Intergenic
1175066309 20:56291521-56291543 CAGGAAACTTCCAATCATGGTGG + Intergenic
1175287538 20:57847189-57847211 CAAGCTGCTTCCACTCATGATGG + Intergenic
1176902108 21:14454755-14454777 CTGGCTTCTTTCATTCATAGTGG - Intergenic
1177085103 21:16694102-16694124 CAGGAAACTTACAATCATAGAGG + Intergenic
1177230553 21:18314822-18314844 CAGGCTAGCACCACTCATATTGG - Intronic
1177393947 21:20509927-20509949 CAGGAAACTTACAATCATAGTGG + Intergenic
1177510665 21:22082999-22083021 CAGGTTACTTCTGCTCATATAGG - Intergenic
1177591642 21:23177832-23177854 CAGGCTAATTGAAATCATAGAGG - Intergenic
1177696611 21:24581133-24581155 CAGGAAACTTCCAATCATGGTGG - Intergenic
1177867643 21:26531590-26531612 CAGGAAACTTCCAGTCATAGTGG - Intronic
1177898690 21:26886371-26886393 CAGGAAACTTCCAATCATGGTGG - Intergenic
1177922414 21:27169103-27169125 CAGGAAACTTACACTCATGGTGG - Intergenic
1177948317 21:27501030-27501052 CAGGCTGCTTCAACTCATGGTGG + Intergenic
1178031575 21:28533068-28533090 CAGGGAGCTTCCACTCATGGTGG + Intergenic
1178098772 21:29243448-29243470 CAGGCTGCTTTCACTCATGGTGG + Intronic
1178110694 21:29367168-29367190 CAGGCTGCTTCCACTCATGGTGG - Intronic
1178310337 21:31524993-31525015 CAGGAAGCTTCCACTCATGGTGG + Intronic
1178320993 21:31605569-31605591 CAGGAAACTTTTACTCATAGTGG - Intergenic
1178321828 21:31611670-31611692 CAGGAAACTTACAATCATAGAGG - Intergenic
1178349254 21:31860573-31860595 CAGGCTGCTTCCACTCAAGGTGG + Intergenic
1178361202 21:31949782-31949804 CAGGCCGCTTCCACTCATGGTGG + Intronic
1178387377 21:32163933-32163955 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1178396729 21:32249686-32249708 CAGGAAGCTTCCACACATAGGGG + Intergenic
1178408600 21:32346197-32346219 CAGGCTGCTTCCACTCATGGTGG - Intronic
1178603132 21:34012282-34012304 CAGGCTGCCTCCACGCATGGTGG - Intergenic
1178740322 21:35194005-35194027 CAGGAAACTTACAATCATAGCGG + Intronic
1178802338 21:35807813-35807835 CAGGAAGCTTCCAATCATAGTGG + Intronic
1179077909 21:38141300-38141322 CAGGGAACTTACAATCATAGTGG - Intronic
1179345827 21:40556580-40556602 CAGACAGCTTCCACTCATGGTGG + Intronic
1179420080 21:41228493-41228515 CAGGCTGCTTCCAGTCATGGTGG + Intronic
1179535127 21:42046550-42046572 CAGGCTGCTTCCACTTATGGGGG + Intergenic
1179620197 21:42609415-42609437 CAGGAAACTTACAATCATAGTGG + Intergenic
1180259207 21:46656234-46656256 CAGGCTATTTCCCCTCACGGTGG - Intronic
1181890491 22:26058765-26058787 CAAGCTGCTTCCACTCATGATGG - Intergenic
1181975993 22:26730247-26730269 CAGGAAACTTACAATCATAGTGG - Intergenic
1182001213 22:26921349-26921371 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1183762585 22:39836874-39836896 CAGGAAACTTACAATCATAGCGG - Intronic
1185101083 22:48841179-48841201 CAGGAAACTTCCAATCATGGTGG + Intronic
949093639 3:60094-60116 CAGGCTTCTTCCACTCAGAGTGG - Intergenic
949184921 3:1179051-1179073 CAGGACACTTCCACTCATAGGGG + Intronic
949276415 3:2288285-2288307 CAGGCTGCTTCCACTCATTGTGG + Intronic
949705692 3:6814150-6814172 CAGGCTGCTTCCACCCATGGTGG + Intronic
950371051 3:12531001-12531023 CAGGAAACTTACAATCATAGTGG + Intronic
950458958 3:13109696-13109718 CAGGGAGCTTCCACTCATGGTGG - Intergenic
950801974 3:15559977-15559999 CAGGCTGCCTCCACTCATGGGGG + Intergenic
950832673 3:15890696-15890718 CAAGCTCCTTCCACTCATGGTGG - Intergenic
950863426 3:16170450-16170472 CAAGCTGCTTCCATTCATGGTGG + Intergenic
951288825 3:20850125-20850147 CAGGCTGCTTCCACTCATGGCGG + Intergenic
951425789 3:22543559-22543581 CAGGAAACTTGCAATCATAGTGG - Intergenic
951998158 3:28754839-28754861 CAGGCTGCTTTCACTCATAGCGG + Intergenic
952122102 3:30257732-30257754 CATGCTGCTTCCACTCTTGGTGG + Intergenic
952188002 3:30992057-30992079 CAGGAAACTTACAGTCATAGTGG + Intergenic
952253307 3:31674707-31674729 CAGGCTACATCCACTCGTGGTGG - Intronic
952835929 3:37601902-37601924 CAGGCTGATTCTACTCATGGTGG + Intronic
952892130 3:38050470-38050492 CAGTCTGCTTCCACTCATGGGGG + Intronic
953063539 3:39448557-39448579 CAGACTGCTTCCACTCATGGCGG + Intergenic
953230219 3:41058163-41058185 CAGTCTGTTTCCACTCATGGTGG + Intergenic
953296925 3:41728324-41728346 CAGGTTGCTTCCACTTATGGTGG + Intronic
953507554 3:43501167-43501189 CAGGCTGCTTCCACTCATGATGG + Intronic
954273219 3:49525465-49525487 CAGGAAGCTTCCAATCATAGTGG + Intronic
954411424 3:50372876-50372898 CAGGCCACTGGCTCTCATAGGGG + Intronic
955118629 3:56032126-56032148 CAGGCTGCTTCCACTTTTTGTGG - Intronic
955141991 3:56278715-56278737 CATGCTGCTTCCACTCCTGGTGG + Intronic
955355914 3:58232630-58232652 CAGTATGCTTCCTCTCATAGTGG + Intergenic
955551307 3:60088038-60088060 CTGGCTGCTTACACTCATGGTGG + Intronic
956234249 3:67050195-67050217 CAGGCTGCTTCCGCTCATAATGG - Intergenic
956704918 3:71991474-71991496 CAGGAAGCTTCCACTCATGGTGG + Intergenic
956921517 3:73934851-73934873 CAGGCTGCTTCCACTCATGGTGG + Intergenic
957293552 3:78307593-78307615 CAGGATACTTACAATCATAGTGG - Intergenic
957294482 3:78319556-78319578 CAGGAAACTTCCAATCATGGTGG - Intergenic
957610027 3:82453887-82453909 CAGGCAACTTACAATCATGGTGG - Intergenic
957875407 3:86139607-86139629 CAGGAAACTTACAATCATAGTGG - Intergenic
958039224 3:88206496-88206518 CAGGCTGCTTCCACTCATGGTGG + Intergenic
958090303 3:88869209-88869231 CAGGAAACTTACAATCATAGTGG + Intergenic
958189005 3:90160220-90160242 CAGGAAACTTACAATCATAGTGG - Intergenic
958445481 3:94209803-94209825 CAGGCTTCTTCCACTCATGGTGG + Intergenic
958720141 3:97833895-97833917 CAAGCTGCTTCCACTCATGGTGG + Intronic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
959321207 3:104877589-104877611 CAGGCTGCTTCCACTCCTGATGG - Intergenic
959517993 3:107291203-107291225 CAGGCTGCTTCCACTCATGATGG + Intergenic
959569035 3:107862152-107862174 CAGGAAACTTACAATCATAGAGG - Intergenic
959593684 3:108105910-108105932 CAAGCCACTTGCACTCATGGCGG + Intergenic
959777637 3:110187813-110187835 CAGGAAACTTACAATCATAGTGG + Intergenic
959810533 3:110613820-110613842 CAGGAAACTTACACTCATGGTGG - Intergenic
960123248 3:113968977-113968999 CAGGCTGCTTCCAGTCATGATGG + Intronic
960514449 3:118588295-118588317 CAGGCTGCTTCCACTCATGGTGG - Intergenic
960523365 3:118681266-118681288 CAGGCTGCTTCCACTCGTGGGGG - Intergenic
960541839 3:118870385-118870407 CAGGAAACTTACAATCATAGTGG - Intergenic
960724891 3:120660124-120660146 CAGGATGCTTCCAATCATGGTGG - Intronic
961021584 3:123511993-123512015 CATGCTGCTTCCACTCATGGGGG - Intronic
961440667 3:126951220-126951242 CAGGAAACTTACAATCATAGTGG - Intronic
961498646 3:127314967-127314989 CAGGAAGCTTCCACTCATGGTGG + Intergenic
961679166 3:128587265-128587287 CAGGATCCTTCTAGTCATAGTGG + Intergenic
961870825 3:129986834-129986856 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
961871223 3:129989745-129989767 CAGGCTGCTCCCTCTCATGGTGG - Intergenic
962047061 3:131771582-131771604 CAGGCTGCTTCCATTTATGGTGG - Intronic
962429381 3:135305589-135305611 CAGGCTGCTTCTACTTATAATGG - Intergenic
962433828 3:135346505-135346527 CAGGCTGCTTCCACTCATGGTGG - Intergenic
962558154 3:136577515-136577537 CAAGCTACTTCCACTGGTATGGG - Intronic
963170413 3:142244471-142244493 CAGGTTTCTTCAACTCATAGTGG - Intergenic
963297234 3:143559105-143559127 CAGGAAACTTACAATCATAGCGG - Intronic
963427848 3:145155152-145155174 CAGGGAGCTTCCACTCATAGTGG + Intergenic
964267790 3:154920327-154920349 CAGGAAACTTCCAATCATGGTGG + Intergenic
964445521 3:156753384-156753406 CAGGTTGCTTCTACTCATGGTGG - Intergenic
964608547 3:158585365-158585387 CAGGATGCTTCCACTTATGGAGG - Intronic
964820764 3:160766550-160766572 CAGGAAACTTACAATCATAGTGG - Intronic
965756220 3:172029976-172029998 CAGGTTGCTTCCACTCATGCTGG - Intergenic
966265115 3:178030975-178030997 CCTGCTTCTTCCACTGATAGTGG - Intergenic
967006427 3:185387409-185387431 TAGGCTGCTTCCACTCACGGTGG - Intronic
967071419 3:185965696-185965718 CAGGCTGCTTCCACTCACGGTGG + Intergenic
967146337 3:186609423-186609445 TAGGCTGCTTCCACTCATGGCGG - Intergenic
967230365 3:187332123-187332145 CAGGATACTTACAATCACAGTGG + Intergenic
967398159 3:189029886-189029908 CAGGAAGCTTCCAATCATAGCGG - Intronic
967651941 3:191996418-191996440 CAGGCTGCTTCCACTCATGGTGG - Intergenic
967883784 3:194319709-194319731 CAGGAAGCTTCCACTCATGGTGG + Intergenic
967919975 3:194607243-194607265 CAGGCTGCCTCCACTCATGGGGG - Intronic
967931347 3:194692773-194692795 CAGGCTGCTTGCACTCATGGCGG + Intergenic
967953528 3:194859391-194859413 CAGGCTGCTTCCACTTATGGGGG + Intergenic
968224494 3:196965241-196965263 CAGGAAACTTACAGTCATAGCGG + Intronic
969163369 4:5281030-5281052 CAGGAAACTTACAGTCATAGTGG + Intronic
969504739 4:7578216-7578238 CAGGCTACTTCAACTCATGGTGG - Intronic
970040487 4:11791942-11791964 CAGGCTGCTTCAAATCATGGTGG + Intergenic
970235898 4:13957705-13957727 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
970270833 4:14345543-14345565 CAGGAAACTTGCAATCATAGAGG - Intergenic
970293179 4:14599290-14599312 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
970403741 4:15742436-15742458 CAGGCTGCTTCGACTCATGGTGG - Intergenic
970612513 4:17738939-17738961 CAGGCTGCTTCTACTCATGGTGG - Intronic
970809223 4:20072020-20072042 CAGTCTGCTTCCACTCATGGTGG + Intergenic
970935421 4:21564748-21564770 CAGGATGCTTCCACTCATGGTGG + Intronic
970984501 4:22140581-22140603 CAGGAAACTTACAATCATAGAGG + Intergenic
971048121 4:22829020-22829042 CAGGAAACTTACAATCATAGTGG - Intergenic
971175790 4:24281351-24281373 CAGGCTGTTTCCACTCACAGTGG + Intergenic
971575134 4:28263261-28263283 CAGGCTGCTTCAACTCATAGTGG - Intergenic
971589796 4:28452933-28452955 CACTGAACTTCCACTCATAGAGG + Intergenic
971642502 4:29153833-29153855 CAGGAAACTTACACTCATGGAGG + Intergenic
971703514 4:30010748-30010770 CAGGAAACTTACAATCATAGTGG - Intergenic
971716054 4:30178786-30178808 CAGGAAACTTACACTCATGGTGG + Intergenic
971753938 4:30683777-30683799 CAGGAAACTTACACTCATGGTGG - Intergenic
971972584 4:33638912-33638934 CAGGATACTTACAGTCATGGGGG - Intergenic
972096342 4:35351364-35351386 CAGGAAACTTACAATCATAGTGG + Intergenic
972681458 4:41310575-41310597 CAGGAAACTTACAATCATAGTGG + Intergenic
972741355 4:41889740-41889762 CAAGCTGCTTCAACTCATTGTGG - Intergenic
972878296 4:43393215-43393237 CAGGCTGCTTCTACTCATGGTGG + Intergenic
973660406 4:53099559-53099581 CATGCTGCTTCCATTCATGGTGG + Intronic
973826781 4:54715478-54715500 CAGGAAGCTTCCACTCATGGTGG + Intronic
973860768 4:55062496-55062518 CAGGAAACTTACAATCATAGCGG - Intergenic
974125192 4:57687621-57687643 CAGGCTGCTTCCAATCATGATGG + Intergenic
974136697 4:57827067-57827089 CAGGAAACTTACAATCATAGTGG + Intergenic
974142810 4:57909169-57909191 CAGGAAACTTACACTCATGGTGG - Intergenic
974156848 4:58084289-58084311 CAGTCTTCTTCCACTCACAGTGG - Intergenic
974259609 4:59508795-59508817 CAGGCAACTTACAATCATGGTGG - Intergenic
974372955 4:61041612-61041634 CAGGCTGTTTCCATTCACAGTGG + Intergenic
974382596 4:61160631-61160653 CAGGCTATTTCCATTGATGGAGG + Intergenic
974601589 4:64089836-64089858 CAGGCTGTTTCTACTCATGGCGG + Intergenic
974665060 4:64951286-64951308 TGGGCTGCTTCCACTCATCGTGG + Intergenic
975447366 4:74481498-74481520 CAGGAAGCTTCCACTCATGGTGG + Intergenic
975512097 4:75205433-75205455 CAGGCTTCTTCCAAGCACAGTGG - Intergenic
975903328 4:79179877-79179899 CAGGAAACTTACAATCATAGCGG + Intergenic
976198049 4:82552118-82552140 CAGGCTGTTTCCACTCATGGTGG - Intronic
976283213 4:83345986-83346008 CAGGAAACTTACAATCATAGTGG + Intergenic
976345516 4:83995096-83995118 CAAGCTACTGTCACTCATATTGG + Intergenic
976364982 4:84223081-84223103 CAGGAAACTTACAATCATAGCGG + Intergenic
976463823 4:85344566-85344588 CAGGCTGCTTCCACTCATTGTGG - Intergenic
976794375 4:88915929-88915951 CAGGCTGCTTCCACTCATGGTGG - Intronic
976821203 4:89209040-89209062 CAGGTTGCCTCCACTCATGGTGG + Intergenic
977169523 4:93743545-93743567 CAGGGTGCTTCCTCTCATGGTGG + Intronic
977337338 4:95715732-95715754 CAGGCTGCTTCCACTCATGGTGG - Intergenic
977471513 4:97448608-97448630 CAGGAAACTTCCAATCATGGTGG - Intronic
978871151 4:113579625-113579647 CAGGAAGCTTCCAATCATAGTGG - Intronic
979253033 4:118585208-118585230 CAGGCTGATTCCACTCATAGTGG + Intergenic
979446871 4:120824023-120824045 CAGGCTCCTTCTACTCATGGTGG - Intronic
979497830 4:121404606-121404628 CAGGCTGCTTCCAGTCATGGTGG + Intergenic
979986620 4:127324074-127324096 CAGGAAGCTTCCACTCATGGAGG - Intergenic
980193657 4:129559398-129559420 CAAGCTACCTCCACACATTGAGG + Intergenic
980212937 4:129813726-129813748 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
980904677 4:138936841-138936863 CAGGCTGCTTCCACTCATAGCGG + Intergenic
981240363 4:142468709-142468731 CAGGCTACTTCTATTCATGGTGG - Intronic
981260204 4:142709617-142709639 CAGGAAACTTACACTCATGGTGG - Intronic
981330363 4:143501266-143501288 CAGGAAACTTACAATCATAGTGG - Intergenic
981453482 4:144926796-144926818 CAGGAAACTTACAATCATAGTGG - Intergenic
981898493 4:149833914-149833936 CAGGAAACTTACAATCATAGTGG - Intergenic
982093294 4:151898453-151898475 CAGGAAACTTCCAATCATGGTGG + Intergenic
982162757 4:152586463-152586485 CAGGAAGCTTCCACTCATGGTGG - Intergenic
982686245 4:158493075-158493097 CAGGCTCCTTCCACTTATGGCGG + Intronic
982790698 4:159587818-159587840 CAGGGAACTTTCAATCATAGTGG + Intergenic
982816948 4:159897497-159897519 CAGGATACTTACAGTCATGGTGG - Intergenic
982866489 4:160519084-160519106 CAGGCTGCTTCCACTCATGGTGG - Intergenic
982871878 4:160589974-160589996 CTGGCTGCTTCCACTCACAGTGG + Intergenic
982927399 4:161355812-161355834 CAGGATACTTGCAATCATGGTGG + Intergenic
983267422 4:165522246-165522268 CAGGAAACTTCCAATCATGGTGG - Intergenic
983669689 4:170221718-170221740 CAGGCTGCCTCCACACATGGTGG - Intergenic
983678474 4:170323763-170323785 CAGGAAACTTACAATCATAGTGG + Intergenic
983921507 4:173350783-173350805 CAGGAAGCTTCCAATCATAGTGG + Intergenic
984035974 4:174668134-174668156 CAGGAAACTTACAATCATAGTGG - Intronic
984276848 4:177621216-177621238 CAGCCTGCTTCCACTCATAGTGG - Intergenic
984786640 4:183573422-183573444 CAGGAAACTTACAATCATAGTGG + Intergenic
984935003 4:184882248-184882270 CAGGAAGCTTCCACTCATGGCGG - Intergenic
985607855 5:868191-868213 CAGGAAACTTCCAATCATGGCGG - Intronic
986110079 5:4707026-4707048 CAGGAAACTTACAATCATAGTGG - Intergenic
986768592 5:10950655-10950677 TAGGTTGCTTCCACTCATGGTGG + Intergenic
986939348 5:12931426-12931448 CAGGAAACTTACAATCATAGTGG - Intergenic
987069773 5:14325370-14325392 CAGGCTGCTTCCACTCAGCATGG + Intronic
987186341 5:15423994-15424016 CAGGAAACTTACACTCATGGTGG - Intergenic
987723289 5:21665051-21665073 CAGGCTGCTTTCACTCATGGGGG - Intergenic
987857776 5:23443579-23443601 CAGGAAACTTCCAGTCATGGCGG - Intergenic
987870944 5:23615667-23615689 CAGGAAATTTCCAGTCATAGTGG - Intergenic
988053098 5:26055629-26055651 CAGGAAACTTCCAATCATGGTGG + Intergenic
988256904 5:28831836-28831858 CAGGAAACTTACAATCATAGAGG + Intergenic
988378805 5:30475848-30475870 CAGGAAACTTACAATCATAGTGG + Intergenic
988423312 5:31032968-31032990 CTGGCTGCTTCCACTCATGATGG - Intergenic
988548935 5:32182947-32182969 CAGGCTGCTTCCATTCATAGTGG - Intergenic
988593158 5:32566934-32566956 CAGGCTGCCTCCACTCATGGTGG + Intronic
988606560 5:32683609-32683631 CAACCTGCTTCCACTCATGGTGG - Intergenic
988862291 5:35295036-35295058 CAGGCTGCTTCTACTTATAGTGG + Intergenic
989619661 5:43371940-43371962 CAGGCTGCTTCCACTAATGGTGG + Intergenic
989644806 5:43619860-43619882 AAGGCTGCTTCAACTCATGGTGG + Intronic
989659043 5:43779175-43779197 CAGGACACTTACAATCATAGTGG + Intergenic
990130376 5:52574860-52574882 CAGGCTGCTTCTACTAATGGTGG - Intergenic
990513888 5:56514582-56514604 CAGGCTGCTTCCACTCATGGGGG - Intronic
990864817 5:60368835-60368857 CAGGAAACTTACAATCATAGTGG - Intronic
990995702 5:61730323-61730345 CAGGAAGCTTCCACTCATGGTGG + Intronic
991019298 5:61963403-61963425 CAAGCTACTTCCACTGATAAGGG - Intergenic
991028532 5:62057768-62057790 CAGGCAACTTCCTCTGAGAGGGG + Intergenic
991098990 5:62770910-62770932 CAGGGAGCTTCCACTCACAGTGG - Intergenic
992000383 5:72430429-72430451 CAAGCTGCTTCCACTCATGGTGG - Intergenic
992208362 5:74452930-74452952 CAGGCTGCTTCCACTCATGGTGG + Intergenic
992799714 5:80284859-80284881 AAGGTTGCTTCCACTCATGGTGG + Intergenic
992863838 5:80938638-80938660 CAGGAAACTTCCATTCATGGCGG - Intergenic
993003314 5:82404713-82404735 CAGGAAGCTTCCACTCATGGTGG + Intergenic
993178811 5:84521630-84521652 CAGGCTGCTTCCATTCATGGTGG - Intergenic
993202770 5:84838561-84838583 CAGGCTTCTTCCACTCATGATGG - Intergenic
993346820 5:86794397-86794419 CGGGCTGCTTCCACTCATGGTGG - Intergenic
993437408 5:87915013-87915035 CAGGCTGCTTCCACTCATGGTGG + Intergenic
993986413 5:94602750-94602772 CAGGAAACTTACACTCATGGTGG - Intronic
994425331 5:99577531-99577553 CAGGAAACTTACAATCATAGTGG - Intergenic
994436009 5:99734704-99734726 CAGGAAACTTACAATCATAGTGG + Intergenic
994726555 5:103443226-103443248 CAGACTGCTTCCACTCATGGTGG - Intergenic
995066110 5:107864726-107864748 CAGGAAACTTCCAGTCATGGTGG - Intronic
995407946 5:111823063-111823085 CAGGCTGCTTGAACTCATGGGGG + Intronic
995437913 5:112158638-112158660 CAGGAAACTTACAATCATAGCGG + Intronic
995463719 5:112429342-112429364 CAGGCTCCTTCTACTCATGGTGG + Intergenic
995561685 5:113388632-113388654 CAGGACACTTCCAATCATGGCGG - Intronic
995673625 5:114636462-114636484 CAGGAAACTTACAATCATAGTGG + Intergenic
995913168 5:117212351-117212373 CAGACTGCTTCCACTCATAGCGG + Intergenic
996112206 5:119579219-119579241 CAGGCTGCTTCCACTAGTGGTGG - Intronic
996363261 5:122673925-122673947 CAGACTGCTTCTACTCATGGTGG + Intergenic
996398131 5:123033501-123033523 CAGGCTGCTTCCAGTCACGGCGG - Intronic
996480763 5:123972924-123972946 CAGGATACTTACAATCATGGTGG + Intergenic
996663942 5:126035949-126035971 CAGGAAACTTACAATCATAGTGG + Intergenic
996696305 5:126399549-126399571 CAGGCAACTTACAATCATGGTGG - Intronic
996828482 5:127712484-127712506 CAGACTGCTTCCACTAATGGTGG - Intergenic
997925561 5:138027932-138027954 CAGGAAACTTACAATCATAGTGG - Intronic
998072095 5:139205904-139205926 CAGGCAGCTTTCACTCATGGAGG - Intronic
998581982 5:143386048-143386070 CAGGAAACTTACACTCACAGTGG + Intronic
998687704 5:144548640-144548662 CAGGATACTTACAATCATGGCGG - Intergenic
999227159 5:150035271-150035293 CAGACTGCCTCCACTCATGGTGG + Intronic
999566462 5:152867859-152867881 CAGGCTGCTTCTGCTCATGGTGG - Intergenic
999649243 5:153749460-153749482 CAGGCTGCTCCCACTCACGGAGG + Intronic
999845887 5:155479708-155479730 CAGGCTGCTTCTATTCATAGTGG - Intergenic
1000527101 5:162371127-162371149 CAGGAAACTTACAATCATAGTGG + Intergenic
1000703861 5:164487411-164487433 CAGGAAACTTACAATCATAGTGG + Intergenic
1000882752 5:166716395-166716417 TAGGCTGCTTTCACTCACAGAGG + Intergenic
1001326899 5:170734988-170735010 CAGGCTGCTTCCACTCACAGTGG - Intronic
1001327518 5:170739884-170739906 CAGGCTGCTTCCACTCATAGTGG - Intergenic
1001890949 5:175337998-175338020 CAGGAAGCTTTCACTCATAGTGG - Intergenic
1002459497 5:179365978-179366000 CCGGCTGCTTCCACTCATGGAGG - Intergenic
1002471862 5:179440236-179440258 CAGGAAACTTCCAGTCATGGCGG + Intergenic
1002845649 6:942188-942210 CAGGCTGCTTCTACTCATGGTGG + Intergenic
1003077351 6:2994292-2994314 CAGGCTGCCTCTACTCATGGAGG - Intronic
1003219436 6:4145586-4145608 CAGGCTGCTTCCATTCCTGGTGG + Intergenic
1003420013 6:5948856-5948878 CAGGCTGTTTCCACTCACGGTGG + Intergenic
1004060546 6:12192674-12192696 CAGGAAACTTACAATCATAGAGG - Intergenic
1004088634 6:12476423-12476445 CAGGCTTCTTCCACTCATGGTGG + Intergenic
1004167633 6:13270898-13270920 CAGGAAACTTCCAATCATGGAGG + Intronic
1004473575 6:15950464-15950486 CAGGCTGCTTTCACTCATCGTGG - Intergenic
1004624174 6:17359099-17359121 CAGGCTGGTTCCACTCATGGTGG - Intergenic
1005220752 6:23585459-23585481 CAGGAATCTTCCAGTCATAGTGG - Intergenic
1005222417 6:23601841-23601863 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1005358788 6:25010377-25010399 CAGACTGCTTCCACTCAAGGCGG - Intronic
1005433336 6:25781614-25781636 CAGGCAACTTCTGCTCATAGTGG + Intergenic
1005457739 6:26037482-26037504 CAGGAAACTTCCAATCATGGTGG + Intergenic
1005489657 6:26335777-26335799 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1006364190 6:33605554-33605576 CAGGAAACTTCCAATCATGGTGG + Intergenic
1006696964 6:35939514-35939536 CAGGATACTTACAATCATGGTGG - Intergenic
1006938779 6:37737700-37737722 CAGACTGCTTCCACTCATGGTGG + Intergenic
1007615104 6:43174939-43174961 TAGGCTACCTCCTCTCTTAGTGG + Intronic
1008180506 6:48322256-48322278 CAGGAAGCTTCCACCCATAGTGG + Intergenic
1008271541 6:49495703-49495725 CAGGCTGCTTCTACTCATGGTGG - Intergenic
1008423463 6:51329821-51329843 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1008533357 6:52485740-52485762 CAGGCTGCTTCCCTTCATGGTGG - Intronic
1008671281 6:53771862-53771884 CAAGCTGCTTTCACTCATGGAGG + Intergenic
1009058933 6:58374377-58374399 CAGGCTACTTCCACTCATGGTGG + Intergenic
1009059155 6:58376340-58376362 CAGGCTGCTTCCACTCATGTTGG + Intergenic
1009231690 6:61070789-61070811 CAGGCTGCTTCCACTCATGTTGG - Intergenic
1009231908 6:61072746-61072768 CAGGCTACTTCCACTCATGGTGG - Intergenic
1009314747 6:62204053-62204075 CAAGCTGCTTCCACTCATGGTGG - Intronic
1009482965 6:64183185-64183207 CAGGAAACTTACAATCATAGTGG - Intronic
1009521317 6:64685612-64685634 CAGGCTGTTTCCACTCGTGGAGG - Intronic
1009714140 6:67366376-67366398 CAGGAAACTTTCAGTCATAGTGG + Intergenic
1009805065 6:68591692-68591714 CAGGAAACTTACAATCATAGTGG + Intergenic
1010554996 6:77267815-77267837 CGGGCTGCTTCCACTCATTGCGG - Intergenic
1011435566 6:87333111-87333133 CAGGTTGCCTCCACTCATGGTGG + Intronic
1011754193 6:90482637-90482659 CAGGAAACTTACAATCATAGTGG - Intergenic
1011821820 6:91262052-91262074 CAGGAAACTTTCACTCATGGTGG + Intergenic
1012342247 6:98142153-98142175 CAGGAAACTTGCAATCATAGTGG + Intergenic
1013019427 6:106197712-106197734 CAGGCTGCTTCTGCTCATGGTGG - Intronic
1013120546 6:107136973-107136995 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1014641078 6:123911329-123911351 CAGGAAGCTTCCACTCATAGTGG + Intronic
1014876605 6:126668671-126668693 CAGGAAACTTACAATCATAGTGG - Intergenic
1015285984 6:131487103-131487125 CAGGCTTCTTCCACTCATGGTGG + Intergenic
1015481087 6:133710770-133710792 CAGGAAACTTACAATCATAGTGG + Intergenic
1015520898 6:134130275-134130297 CAAGTTGCTTCCACTCATGGTGG - Intergenic
1015591647 6:134828494-134828516 CAGGCTCCTTCCTCACACAGTGG + Intergenic
1015979754 6:138826940-138826962 CAGGGAACTTCCAATCATGGTGG - Intronic
1016193159 6:141295864-141295886 CAGACTGCTCCCACTCATGGTGG + Intergenic
1016460494 6:144276069-144276091 CAGGCTGCTTCTACTCATGACGG + Intergenic
1016682464 6:146846203-146846225 CAGGAAACTTACAGTCATAGTGG + Intergenic
1016683027 6:146852510-146852532 CAGGAAACTTCCAGTCATGGTGG + Intergenic
1016727718 6:147394684-147394706 CAGGAAACTTACACTCATGGTGG + Intergenic
1016836560 6:148483180-148483202 CAGGCTGCTTCCACTTATGGTGG + Intronic
1016861688 6:148726510-148726532 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1017385698 6:153880265-153880287 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1017749702 6:157479901-157479923 CTGTCTACTTTCACTCATGGAGG - Intronic
1018178501 6:161199788-161199810 CAGGAAACTTGCACTCATGGCGG - Intronic
1018554138 6:165033278-165033300 CAGGAAACTTCCAGTCATGGTGG + Intergenic
1018565397 6:165146207-165146229 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1018594657 6:165465617-165465639 CAGGAAACTTACAATCATAGTGG + Intronic
1018595044 6:165470131-165470153 CAGGCTGCTTCCACTCCTGGAGG + Intronic
1018946481 6:168350014-168350036 CAGGAAACTTACAGTCATAGTGG + Intergenic
1019602230 7:1890457-1890479 CAGGCTGCGTCCACTCATGGCGG - Intronic
1019882166 7:3871588-3871610 CAGGCTGCTTCCATTCATTGTGG + Intronic
1019885813 7:3903973-3903995 CAGGCTGCTTCCACTCATGGTGG - Intronic
1020339524 7:7094785-7094807 CAGGAAGCTTCCATTCATAGTGG - Intergenic
1020754762 7:12188992-12189014 CAGGCTTCTTCTACTCATGGTGG - Intergenic
1021246888 7:18274306-18274328 CATGCTGCTTCAACTCATGGTGG + Intronic
1022127460 7:27372233-27372255 CAGGAATCTTCCACTCATGGCGG + Intergenic
1022409609 7:30128804-30128826 CAGGCTGCTTCCACTCAAGGTGG + Intronic
1022416579 7:30183297-30183319 CAGGAAACTTACAATCATAGTGG + Intergenic
1022782527 7:33600947-33600969 CAGGCTACTTTTATTCATGGGGG + Intronic
1022917148 7:34968892-34968914 CAAGCTACCTCCATTTATAGTGG + Intronic
1023305134 7:38818134-38818156 CAGGTGACATCCACTTATAGGGG - Intronic
1023706195 7:42944020-42944042 CAGGAAGCTTCCAGTCATAGTGG - Intronic
1023926132 7:44671183-44671205 CAGGCTGCTTCCACTCCTAGTGG + Intronic
1024351184 7:48366586-48366608 CATGCCACTTCAACTCATGGCGG + Intronic
1024467767 7:49730747-49730769 CAGGTTGTTTCCACTCATGGTGG - Intergenic
1024677563 7:51650750-51650772 CAGGCTGCTTCCACTCATGATGG - Intergenic
1024845594 7:53637743-53637765 CAGGAAACTTACAATCATAGAGG - Intergenic
1024936947 7:54720108-54720130 CAGGAAACTTTCAGTCATAGAGG - Intergenic
1025987424 7:66465809-66465831 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1026003708 7:66583418-66583440 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1026043305 7:66886924-66886946 CAGGAGGCTTCCACTCATGGCGG + Intergenic
1026218244 7:68368505-68368527 CAGGAAACTTACAATCATAGCGG - Intergenic
1026354329 7:69544295-69544317 CAGGAAACTTACAATCATAGTGG - Intergenic
1026506573 7:70989582-70989604 CAGGCTGCTTGCCCTCATGGTGG - Intergenic
1026594389 7:71722217-71722239 TGGGCTGCTTCCACTCATGGGGG + Intergenic
1026675740 7:72426491-72426513 CAGGAAACTTACACTCATGGCGG - Intronic
1027290470 7:76703807-76703829 CAGGCTGCTTCCACTGATTGTGG - Intergenic
1027424896 7:78052409-78052431 CAGGCGGCTTCCACTCCTGGCGG - Intronic
1027516128 7:79144484-79144506 CAGGAAACTTCCAATCATGGTGG - Intronic
1027580711 7:79991400-79991422 CAGGCTGCATACACTTATAGTGG - Intergenic
1027677649 7:81179937-81179959 CAGGAAGCTTCCAATCATAGCGG - Intronic
1028498937 7:91496538-91496560 CAGGAAACTTCCAATCATGGTGG - Intergenic
1028516047 7:91679320-91679342 CAGACTGCTTCCACTAATGGTGG - Intergenic
1028845221 7:95472600-95472622 CAGTCTACTCTCACTAATAGGGG + Intergenic
1030029843 7:105358883-105358905 CAGGCTGCTTCCACCCATGCTGG + Intronic
1030384968 7:108857365-108857387 CAGGCAACTTACAATCATGGTGG + Intergenic
1030602225 7:111605514-111605536 CAAGCTGCCTCCACTCATGGTGG - Intergenic
1031009095 7:116505541-116505563 CAGGAAGCTTCCACTTATAGTGG + Intronic
1031074051 7:117195557-117195579 CAGGAAACTTACATTCATAGCGG + Intronic
1031506964 7:122596938-122596960 CAGGCTGCTTCCACACCTGGTGG + Intronic
1032311016 7:130787186-130787208 CATGCTGCTTCCACTCATGATGG - Intergenic
1032436220 7:131902399-131902421 CAGGCTACTTCCACTCATAGTGG - Intergenic
1032752466 7:134855041-134855063 CAGGAGACTTTCAATCATAGTGG - Intronic
1033082053 7:138307681-138307703 CAGTCTACTTCCATTCATACAGG + Intergenic
1034543970 7:151777580-151777602 CAGGCTGCTTCCACTCATGGAGG - Intronic
1034726440 7:153340550-153340572 CAGCCTGCTTCCACTCATGGAGG + Intergenic
1034973417 7:155433545-155433567 CAGGCAGCTTCCAGTCATGGTGG - Intergenic
1035030494 7:155854179-155854201 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1035301572 7:157901037-157901059 CAGGCTGCTTCCACTTGCAGTGG + Intronic
1035724375 8:1815409-1815431 CAGGCTGCTTCCACTCACGGTGG + Intergenic
1036387913 8:8297771-8297793 CAGGTTGCTTCCACTCTTGGTGG - Intergenic
1036509103 8:9383933-9383955 CAGGCTGCTTCCACTCAAGTTGG - Intergenic
1036526713 8:9541696-9541718 CAGGCTGCTTCCATTTATGGTGG - Intergenic
1036717798 8:11142654-11142676 CAGGAATCTTCCAGTCATAGTGG - Intronic
1037386136 8:18344014-18344036 GAGGAAACTTCCACTCATGGTGG - Intergenic
1037393750 8:18420690-18420712 CAGGCTGCTTCCACACATGGTGG - Intergenic
1037472049 8:19220342-19220364 CAGGAAACTTACAATCATAGTGG + Intergenic
1037503416 8:19506786-19506808 CAGGCTGCTTCCACTCATGGTGG - Intronic
1037557872 8:20043038-20043060 TAGGCTGCTTCAACTCATGGTGG - Intergenic
1037573223 8:20176315-20176337 CAGGGAGCTTCCACTCATGGTGG - Intronic
1037621318 8:20565980-20566002 CAGCAAACTTCCAATCATAGTGG - Intergenic
1037717937 8:21415438-21415460 CAGACTGCTTCCACTCAAGGTGG - Intergenic
1037970679 8:23169600-23169622 CAATCTACTTCCATTCATATAGG - Intergenic
1038270892 8:26074895-26074917 CAGGCTGCTTCCACTCATGGCGG + Intergenic
1038572921 8:28678564-28678586 CAGGCTGCTTTCACTCATGGGGG - Intronic
1038599680 8:28927457-28927479 CAGGCTACTTCCACTCATGGTGG + Intronic
1038701715 8:29855302-29855324 CAGCCTGCTTCCACTCATGGTGG - Intergenic
1038880581 8:31606420-31606442 CAGGATACTTACAATCATGGTGG + Intergenic
1038893048 8:31748787-31748809 CAGGCTACTGCTAATCAAAGTGG - Intronic
1038922141 8:32096607-32096629 CAGGCCACTTCCCCTCATGGAGG + Intronic
1038939365 8:32286695-32286717 CAGGAAACTTCTACTCATGGTGG - Intronic
1039015667 8:33146379-33146401 CAGGAAACTTACAATCATAGCGG + Intergenic
1039028338 8:33282599-33282621 CATGCTATTTTCACTTATAGTGG + Intergenic
1039035169 8:33351581-33351603 TAGGCTGCTTCCACTCTTGGTGG - Intergenic
1039189412 8:34955791-34955813 CAGGCTGCTGCCACTCATGGTGG + Intergenic
1039327255 8:36499052-36499074 CAGGCTCCCTCAACTCATGGTGG - Intergenic
1039407125 8:37322932-37322954 CAGGTTGCTTGCACTCATGGTGG + Intergenic
1039765358 8:40622681-40622703 CAGGAAGCTTCCACTCATGGCGG + Intronic
1039922179 8:41901114-41901136 CAGGCTGCTTCCAGTCATGGTGG - Intergenic
1040055481 8:43053867-43053889 CAGGCTGCTTCAACTCATGGGGG + Intronic
1040436025 8:47392321-47392343 TAGGCTACTACCACTCCAAGTGG + Intronic
1040525648 8:48222237-48222259 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1040574212 8:48636707-48636729 CGTGCTACTTCAACTCATGGTGG - Intergenic
1040914889 8:52558929-52558951 CAGGCTGCTTCCACTCATGATGG + Intronic
1041335824 8:56781719-56781741 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1041341035 8:56845612-56845634 CAGGAAACTTACAATCATAGTGG + Intergenic
1041598276 8:59683146-59683168 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1042266232 8:66911370-66911392 CAGGACACTTACAGTCATAGTGG - Intronic
1042488852 8:69376637-69376659 CAGGAAACTTACACTCATGGAGG - Intergenic
1042490214 8:69389243-69389265 CAGGCCTCTTCCACTCATTGTGG + Intergenic
1042899049 8:73703330-73703352 CAGGATGCTTCCAATCATGGTGG - Intronic
1043104815 8:76094549-76094571 CAGGCTGCTTCCACTCATGGGGG - Intergenic
1043144819 8:76639709-76639731 CAGGAAACTTACAATCATAGTGG - Intergenic
1043421301 8:80101626-80101648 CAGGAAGCTTCCACTCATAGTGG + Intronic
1043704859 8:83335473-83335495 CAGGAAACTTACAATCATAGTGG - Intergenic
1043779571 8:84314045-84314067 CAGGAAACTTCCAATCATGGTGG + Intronic
1043798834 8:84580402-84580424 CAGGCAGCTTTCACTCAAAGTGG + Intronic
1044068427 8:87725583-87725605 CAGGAAACTTACAATCATAGTGG + Intergenic
1044130008 8:88509950-88509972 CGGACTACTTCCACTCATGGTGG - Intergenic
1044446871 8:92288546-92288568 TAGGCCACTTCCACTCAGGGTGG + Intergenic
1044801101 8:95957260-95957282 TAAGCTGCTTCCACTCATGGTGG - Intergenic
1044923920 8:97193657-97193679 CAGGCTGCTTCAACTCATGGTGG - Intergenic
1044943625 8:97369417-97369439 CAGGCAAATTCCACTAACAGAGG - Intergenic
1044984945 8:97748972-97748994 GAGGCTACTTCCACTCATGGGGG + Intergenic
1045014211 8:97985151-97985173 AAGGCTGCTTCCACTCACAGCGG + Intronic
1045416335 8:101971564-101971586 CAGGAAACTTCCAGTCATGGTGG - Intronic
1045430768 8:102112901-102112923 CAGGCTGCTTCCATTCATGATGG - Intronic
1045594851 8:103641815-103641837 CAAGTTGCTTCCACTCATGGTGG - Intronic
1045993560 8:108338301-108338323 CAGGATACTTACAATCATGGTGG + Intronic
1046040468 8:108897279-108897301 CACACTGCTTCCACTCATAGTGG - Intergenic
1046211093 8:111077574-111077596 CAGGAAACTTACACTCATAGCGG - Intergenic
1046236495 8:111429910-111429932 CAGGCTGCTTCCTCTCCTGGAGG + Intergenic
1046488471 8:114916560-114916582 CTGGCTACTTCCACTAAAAAAGG + Intergenic
1046839724 8:118842844-118842866 CAGGCTATTTCCACTCATGGTGG - Intergenic
1047304677 8:123643124-123643146 CGGGCTACTTCCATTCATGGTGG + Intergenic
1047533838 8:125701257-125701279 CAGGCTGCTTCCCCTTATGGTGG + Intergenic
1047865246 8:129016513-129016535 CAGGAAACTTACAATCATAGTGG - Intergenic
1047877079 8:129150297-129150319 CAAGATCCTTCCCCTCATAGGGG + Intergenic
1048013755 8:130479843-130479865 CAGAAAACTTCCACTCATGGCGG + Intergenic
1048025594 8:130583922-130583944 CAGACTGCTTCCACTCATGTGGG + Intergenic
1048226712 8:132594750-132594772 CAGGAAACTTACACTCATGGTGG - Intronic
1048516431 8:135115869-135115891 CAGGCTGCTTCCACTCTTGGTGG + Intergenic
1048578877 8:135714688-135714710 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1048653011 8:136501613-136501635 CAGGCTGCGTCCACCCATGGTGG - Intergenic
1048849525 8:138631078-138631100 CAGGGAACTTCCCATCATAGAGG - Intronic
1049498573 8:142948546-142948568 CAGGCTGCCTCCACTCATGGTGG + Intergenic
1049830457 8:144698277-144698299 CAGGCTGCTTTCACTTATGGTGG - Intergenic
1050120327 9:2301143-2301165 CAGGAAACTTACAATCATAGTGG + Intergenic
1050495944 9:6242881-6242903 CAGGCTATTTCCACTCATGATGG + Intronic
1050563461 9:6858105-6858127 CAGGTTACTGCCAGGCATAGTGG - Intronic
1050582533 9:7075590-7075612 CAGGCTGCTTCAACTCACTGTGG - Intronic
1050868350 9:10533169-10533191 CAGGCTGCTTCCACTCCTGGAGG - Intronic
1050974060 9:11914153-11914175 CAGGAAACTTACAATCATAGTGG + Intergenic
1051551393 9:18333412-18333434 CAGGAAACTTACAATCATAGTGG - Intergenic
1052193724 9:25686821-25686843 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
1052282937 9:26753811-26753833 CAGTCTGCTTCCACTCATGGTGG + Intergenic
1053537507 9:38939825-38939847 CAAGCTGCTTCCACTCATGCGGG - Intergenic
1053652321 9:40181697-40181719 CAGGAAACTTACAATCATAGTGG + Intergenic
1054532261 9:66194518-66194540 CAGGAAACTTACAATCATAGTGG - Intergenic
1054628628 9:67424105-67424127 CAAGCTGCTTCCACTCATGCGGG + Intergenic
1054834468 9:69661858-69661880 CATGCTGCTTCCACTCATAGTGG - Intronic
1055209911 9:73779268-73779290 CAGGAAACTTACACTCATGGTGG - Intergenic
1055369675 9:75583918-75583940 CAGGAAACTTACAATCATAGCGG + Intergenic
1055434070 9:76274884-76274906 CAGGCTGCTTCCACTCATGGTGG + Intronic
1055665540 9:78549304-78549326 CAGGAAACTTACAATCATAGTGG - Intergenic
1055782512 9:79834667-79834689 TAGGCTGCTTCCATTCATGGTGG + Intergenic
1056113594 9:83420836-83420858 CAGGCTGCTTCCACTGACGGTGG - Intronic
1056371253 9:85956883-85956905 TAGGCTGCTTCAACTCATGGTGG + Intronic
1056949548 9:91031077-91031099 CAGGCTGCTTCCATGCATGGTGG - Intergenic
1057005250 9:91551620-91551642 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1057092017 9:92266791-92266813 CAGGCTACATCCACTTATGATGG - Intronic
1057113505 9:92497967-92497989 CAGGCTGCTTCCACTCATGGTGG - Intronic
1058182083 9:101810360-101810382 CAGGAGACTTACACTCATGGTGG - Intergenic
1058770129 9:108222886-108222908 CAGGCTTCTTCCACTTATGGTGG - Intergenic
1058808644 9:108617599-108617621 CAGGCTGCTTCCCCTCATGGTGG - Intergenic
1058852548 9:109026914-109026936 CAGGAAACTTCCAATCATGGTGG - Intronic
1058918798 9:109593670-109593692 CAAGCTGCTTCCACTCATGGAGG + Intergenic
1060755803 9:126212493-126212515 CAGGAAACTTCCAATCATAGAGG - Intergenic
1060789056 9:126473519-126473541 CAGGAAGCTTCCAATCATAGTGG + Intronic
1061708751 9:132473028-132473050 CAGGCTGCTTCCACTCACAGCGG + Intronic
1061830200 9:133287056-133287078 CAGACTGCTTCCACTCAAGGCGG + Intergenic
1062403115 9:136381063-136381085 CCGGCATCTTCCACTCATACTGG + Intronic
1185674803 X:1840573-1840595 CAGGAAACTTCCACTCCTGGTGG - Intergenic
1185715491 X:2338688-2338710 CAGGAGGCTTCCACTCATGGTGG - Intronic
1185742580 X:2545701-2545723 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1185921424 X:4097139-4097161 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1186093561 X:6075767-6075789 CAGGAAGCTTCCACTCATGGTGG - Intronic
1186149346 X:6657669-6657691 CAGGCTGCTTCCACTCAGGATGG - Intergenic
1186188341 X:7043432-7043454 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1186415097 X:9376472-9376494 CAGGGAACTTCCAATCATGGTGG + Intergenic
1186421005 X:9426427-9426449 CAGTCTGCTTCCACTCATGGTGG + Intergenic
1186920291 X:14271093-14271115 CAGGCTGCTTTCACTCATGGGGG - Intergenic
1187123450 X:16431207-16431229 CAGGATGCTTCCACTCATGGTGG - Intergenic
1187435657 X:19266527-19266549 CAGGAAACTTACAATCATAGTGG - Intergenic
1187529986 X:20087445-20087467 CAGGCTACTTCCACTCATGGTGG - Intronic
1187686837 X:21824245-21824267 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1187995181 X:24918754-24918776 CGGGCTGCTTCCTCTCATGGGGG + Intronic
1188221386 X:27545760-27545782 CAGGAAACTTACAATCATAGTGG + Intergenic
1188293854 X:28421285-28421307 CAGAATGCTTCCACTCATGGTGG + Intergenic
1188295350 X:28440762-28440784 CAGGCTGCTTCCACACATGGTGG - Intergenic
1188364635 X:29300039-29300061 CAGGCTGCTTCCACTTATAGTGG - Intronic
1188744100 X:33820503-33820525 CAGGAAACTTTCACTCATGGAGG - Intergenic
1189109736 X:38276338-38276360 CATTCTACTTCCACTCATGCGGG + Intronic
1189139412 X:38585877-38585899 CAGGCTACTTCCACACATGGTGG - Intronic
1189201091 X:39196250-39196272 CAAGCTGCCTCCACTCATGGTGG + Intergenic
1189553222 X:42114568-42114590 CAGGAAACTTACAATCATAGTGG + Intergenic
1189845473 X:45132454-45132476 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1189851171 X:45177550-45177572 CAGGAAGCTTCCACTCATGGTGG - Intronic
1189869556 X:45368058-45368080 CAGGAAACTTACAATCATAGTGG - Intergenic
1190032318 X:46986092-46986114 CAGGCTGCTTCTACTCATGGTGG - Intronic
1190138961 X:47824406-47824428 CAGGGTGCCTCTACTCATAGTGG + Intergenic
1190537008 X:51439304-51439326 CAGATTGCTTCCACTCATGGTGG + Intergenic
1190690651 X:52910411-52910433 CGGGCTGCTTCAACTCATGGTGG - Intergenic
1190695332 X:52945381-52945403 CGGGCTGCTTCAACTCATGGTGG + Intronic
1191097998 X:56694889-56694911 CAGTCTGCTTCCACTCATGATGG + Intergenic
1191658127 X:63621762-63621784 CAGGCTACTTCCGCTCATGGTGG - Intergenic
1191736943 X:64397049-64397071 CAGGAAACTTCCAGTCATGGTGG - Intergenic
1192030567 X:67508311-67508333 CTGGATGCTTCCACTCATAGTGG - Intergenic
1192124870 X:68492688-68492710 CAGGCTGCTTCAACTCACTGTGG + Intergenic
1192316760 X:70058356-70058378 CAGGACACTTCCAATCATGGAGG + Intergenic
1192418112 X:71002655-71002677 CAGGAAACTTACAATCATAGTGG - Intergenic
1192596498 X:72413777-72413799 CAGGAAACTTACAGTCATAGTGG - Intronic
1193022348 X:76803696-76803718 CAGGCTGCTTCCAGTCATGGTGG - Intergenic
1193090864 X:77492730-77492752 CAGGAAACTTTCAATCATAGTGG - Intergenic
1193143634 X:78055170-78055192 CAGGAAACTTACAATCATAGTGG - Intergenic
1193212529 X:78823974-78823996 GATGCTATTTCCAATCATAGTGG - Intergenic
1193326525 X:80184205-80184227 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1193393223 X:80954229-80954251 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1193547636 X:82849387-82849409 CAGGCTGTTTCCACTTATGGTGG - Intergenic
1193634479 X:83931279-83931301 CAGGAAACTTTCAATCATAGTGG - Intergenic
1193929972 X:87541590-87541612 CAGGAAACTTACAATCATAGTGG - Intronic
1193949860 X:87784490-87784512 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1194259570 X:91677161-91677183 CAGGAAACTTACAGTCATAGTGG + Intergenic
1194497603 X:94636316-94636338 CAGGAAACTTACAATCATAGTGG - Intergenic
1195556009 X:106225119-106225141 CAGGCTGTTTCCACTCATAATGG - Intergenic
1195627412 X:107018628-107018650 CAGGCTGCTTCAACTCATGAAGG + Intergenic
1196288087 X:113905782-113905804 CAGGCTTCCCCCACTCATAGTGG - Intergenic
1196309824 X:114150629-114150651 CAGGCAACTTACAATCATAGTGG - Intergenic
1196343578 X:114625534-114625556 CGGGCTGCTTCCACTCATGGTGG - Intronic
1196500406 X:116374384-116374406 CAGGCTGCTTTCTCTCATGGCGG + Intergenic
1196624353 X:117861114-117861136 CAGGAAACTTACAATCATAGTGG - Intergenic
1196776458 X:119342658-119342680 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1196868819 X:120094010-120094032 CAGGAAGCTTCCACTCATGGAGG + Intergenic
1197347940 X:125346862-125346884 CTGGGTACTTCCACTCATGATGG + Intergenic
1197983342 X:132241625-132241647 CAGGAAACTTACAATCATAGCGG - Intergenic
1198070473 X:133143354-133143376 CAGGCTACTTCCACTTATGGTGG - Intergenic
1198074386 X:133180550-133180572 CAGGGAACTTCCAATCATGGTGG - Intergenic
1198220742 X:134599481-134599503 CAGGAAACTTACACTCATGGCGG - Intronic
1198843697 X:140886275-140886297 CAGACTGCTTTCACTCATGGTGG - Intergenic
1198870278 X:141171672-141171694 CAGGAAACTTCCAGTCATGGAGG - Intergenic
1198986676 X:142462716-142462738 CAGGTAGCTTCCAATCATAGGGG - Intergenic
1198988742 X:142486237-142486259 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1199117886 X:144014127-144014149 CAGGAAACTTACAATCATAGTGG + Intergenic
1199160430 X:144603710-144603732 CAGGAAACTTACAATCATAGTGG - Intergenic
1199230108 X:145426841-145426863 CAGGAAACTTACAATCATAGTGG - Intergenic
1199296381 X:146163386-146163408 CAGGCAGCTTCCAATCATGGTGG - Intergenic
1199328511 X:146530699-146530721 CAGGCTGCTTCTACTCATGGCGG + Intergenic
1199338865 X:146651826-146651848 CAGGAAACTTACAATCATAGTGG + Intergenic
1199355090 X:146853198-146853220 CAGGTTGCTTCCACTCGTGGGGG - Intergenic
1199463112 X:148105414-148105436 CAGGAAACTTACAATCATAGCGG - Intergenic
1199619235 X:149684829-149684851 CAGGAAACTTCCAATCATGGTGG - Intergenic
1199741562 X:150740775-150740797 CAGGCTGCTTCCACTCATGGTGG + Intronic
1200257838 X:154594239-154594261 CGGGCTGCTTCCACTCATTGTGG - Intergenic
1200344911 X:155438449-155438471 GAGGCTGCTTCCATTCATTGTGG - Intergenic
1200380378 X:155831049-155831071 CAGGAAACTTCCAATCATGGTGG + Intergenic
1200578272 Y:4916354-4916376 CAGGAAACTTACAGTCATAGTGG + Intergenic
1201341948 Y:12943571-12943593 CAGTTTGCTTCCACTCATGGTGG - Intergenic