ID: 918367266

View in Genome Browser
Species Human (GRCh38)
Location 1:183821566-183821588
Sequence CACTTTATAGATTTTAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918367260_918367266 16 Left 918367260 1:183821527-183821549 CCTGGTCTGCTCTGTAAGAGGGC 0: 1
1: 0
2: 1
3: 9
4: 136
Right 918367266 1:183821566-183821588 CACTTTATAGATTTTAGGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 146
918367257_918367266 24 Left 918367257 1:183821519-183821541 CCAGGAGGCCTGGTCTGCTCTGT 0: 1
1: 0
2: 1
3: 31
4: 303
Right 918367266 1:183821566-183821588 CACTTTATAGATTTTAGGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918367266 Original CRISPR CACTTTATAGATTTTAGGTC TGG Intronic