ID: 918371828

View in Genome Browser
Species Human (GRCh38)
Location 1:183868823-183868845
Sequence TATCCAGAGCTGGCCGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 1, 2: 15, 3: 110, 4: 769}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918371821_918371828 25 Left 918371821 1:183868775-183868797 CCATTCAATTAGCCACCTGAACA 0: 1
1: 0
2: 0
3: 9
4: 117
Right 918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG 0: 1
1: 1
2: 15
3: 110
4: 769
918371823_918371828 13 Left 918371823 1:183868787-183868809 CCACCTGAACACTCTGAGGAGAG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG 0: 1
1: 1
2: 15
3: 110
4: 769
918371824_918371828 10 Left 918371824 1:183868790-183868812 CCTGAACACTCTGAGGAGAGTCA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG 0: 1
1: 1
2: 15
3: 110
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918371828 Original CRISPR TATCCAGAGCTGGCCGGGCG TGG Intronic
900237860 1:1601008-1601030 TATGCAGACGTGGCCGGGCCTGG + Intergenic
900284998 1:1894781-1894803 GACCCAGAGCTGACCGGGTGTGG - Intergenic
900340502 1:2186498-2186520 AAGCCTGAGCTGGCCGGGGGGGG - Intronic
900527887 1:3138005-3138027 TGTGCAGAGCTGGCCAGGCAGGG + Intronic
901039702 1:6356483-6356505 TGTCCAGGGCTGGCCAGGTGTGG - Intronic
901107653 1:6769799-6769821 TATACAAAAATGGCCGGGCGCGG + Intergenic
901400658 1:9013318-9013340 CCTTCAGAGCCGGCCGGGCGCGG - Intronic
901554022 1:10017483-10017505 TATCTTGAGCAGGCCGGTCGCGG - Intergenic
901704933 1:11066469-11066491 AATCCAGAGCCGGCCGGGTGCGG - Intergenic
901728825 1:11263178-11263200 AATCAATAGCTGGCCCGGCGCGG + Intergenic
901839457 1:11944818-11944840 TTGCCAGAGCTGGCGGGGCAGGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902186287 1:14727993-14728015 AATCTAATGCTGGCCGGGCGCGG + Intronic
902305277 1:15533205-15533227 TCTCCAAAGCTGGCCGGGTGTGG + Intronic
902411548 1:16214739-16214761 AACCCAGGTCTGGCCGGGCGTGG + Intergenic
902438603 1:16414602-16414624 TAATCATAGCTGGACGGGCGCGG + Intronic
902546074 1:17191060-17191082 TAACCACACCTGGCCGGGCACGG + Intergenic
902558160 1:17259387-17259409 TATACACAGTCGGCCGGGCGTGG - Intronic
902870852 1:19312653-19312675 TTTCCCGGGCCGGCCGGGCGAGG + Exonic
903080570 1:20808389-20808411 AATGAAGAGGTGGCCGGGCGCGG + Intronic
903403509 1:23076679-23076701 TATCCAGGGAAGGCCGAGCGTGG + Intronic
903418777 1:23203187-23203209 TTTCCAGATTTGGCCGGGCGCGG - Intergenic
903492109 1:23737115-23737137 TATGGAGTGCTGGCCAGGCGTGG + Intergenic
903565238 1:24260220-24260242 GTTCTAGAGCTGGCCGGGCGCGG + Intergenic
904039463 1:27575707-27575729 TAGCCACGTCTGGCCGGGCGGGG + Intronic
904098987 1:28006414-28006436 AATCCATAACTAGCCGGGCGCGG + Intronic
904651453 1:32009001-32009023 AAAACAGAGATGGCCGGGCGCGG - Intergenic
904774000 1:32895735-32895757 TGTCCAGCGCTGGACGGGGGAGG + Exonic
905090859 1:35430236-35430258 TCCCCAAAGATGGCCGGGCGCGG - Intergenic
905136610 1:35805427-35805449 CAACTAGAGTTGGCCGGGCGCGG - Intergenic
905521575 1:38604541-38604563 AAACCACACCTGGCCGGGCGCGG - Intergenic
905591304 1:39166396-39166418 TATCTAGTGCTGGCAGGGCATGG - Intronic
905943992 1:41886420-41886442 TATACAGAGCGGTCCGGGTGCGG + Intronic
906136704 1:43505262-43505284 TCTCCAGGGCTGGCCGGCAGGGG - Intergenic
906500711 1:46340350-46340372 TTTCGGGACCTGGCCGGGCGTGG - Exonic
906915264 1:50002657-50002679 GAACTAGGGCTGGCCGGGCGCGG - Intronic
907032514 1:51186374-51186396 TACCCACTGCTGGCCGGGCATGG + Intergenic
907352566 1:53844871-53844893 AATCAAGAACTGGCCGGGTGCGG - Intergenic
907831110 1:58064998-58065020 TATCTATTGTTGGCCGGGCGCGG - Intronic
908138243 1:61155381-61155403 ATTCTAGAGTTGGCCGGGCGCGG + Intronic
908347536 1:63250608-63250630 TATTATGGGCTGGCCGGGCGTGG - Intergenic
908837615 1:68243834-68243856 TATAAAGAGTTGGCCGGGCGTGG + Intergenic
908847347 1:68338585-68338607 TGTCCAGGGCTGGCTGGGCATGG + Intergenic
909804424 1:79857401-79857423 AAGCCATAGCTGGCCAGGCGCGG + Intergenic
909911318 1:81261013-81261035 TATCAGGTGCCGGCCGGGCGCGG - Intergenic
910294245 1:85628555-85628577 TATTAAGAACTGGCCGGGCATGG - Intergenic
910304526 1:85747402-85747424 TATCAAAAGTTGGCCGGGCACGG - Intronic
910472624 1:87571632-87571654 TATCCAGGCGTGGCCGGGCACGG - Intergenic
910567917 1:88666476-88666498 TTCCCAGACCTGACCGGGCGCGG + Intergenic
911346916 1:96708177-96708199 TATCCAGTGGTGGCCGGGTACGG - Intergenic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912343897 1:108946017-108946039 TAGCCAGACGTGGCCGGGCGCGG + Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912800858 1:112719040-112719062 TCTGCAGAGCTGGCGGGGCCGGG + Intergenic
914251213 1:145923217-145923239 TAGTCAAAGCTGGCTGGGCGCGG - Intergenic
914374642 1:147062160-147062182 ACGCCACAGCTGGCCGGGCGGGG - Intergenic
914706902 1:150177631-150177653 TATGAAGTACTGGCCGGGCGCGG - Intergenic
915143695 1:153782032-153782054 TAACCTGAGCCGGCCGGGCGCGG - Intergenic
915233072 1:154460282-154460304 TGTCCAGAGCTGGCCTGGATGGG - Intronic
915501055 1:156318000-156318022 TAACTGGAGCTGGCCGGGCGTGG - Intronic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
915750744 1:158207568-158207590 TATCTTGAGGCGGCCGGGCGCGG - Intergenic
916040659 1:160958473-160958495 TATCCAGAATTGGCCGGGCTTGG - Intergenic
916100257 1:161388329-161388351 AATCCATTCCTGGCCGGGCGCGG + Intergenic
916279447 1:163032830-163032852 TATTCATAGCTGGCCGGGCTCGG - Intergenic
917763896 1:178197165-178197187 TAGCCAGGTGTGGCCGGGCGTGG + Intronic
917849232 1:179046358-179046380 TATAAAGAGATGGCCGGGCACGG + Intronic
918282720 1:183022853-183022875 GACCCACACCTGGCCGGGCGGGG + Intergenic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
918977140 1:191504097-191504119 TATACAGGACCGGCCGGGCGCGG - Intergenic
919365743 1:196658713-196658735 TTACCTGAGCAGGCCGGGCGCGG - Intronic
919676391 1:200387782-200387804 CAGCAAGAACTGGCCGGGCGTGG + Intergenic
919930771 1:202220168-202220190 AACACAGTGCTGGCCGGGCGCGG - Intronic
920639625 1:207739410-207739432 TATCCAAAGCTGGCCAGGCACGG - Intergenic
921847952 1:219904207-219904229 TTTTCTGAGCTGGCCGGGCACGG + Intronic
921885043 1:220296962-220296984 GATCCATAGCTGGCTGGGTGTGG - Intergenic
922634964 1:227159194-227159216 TTTCCAAAGTTGGCCGGGCACGG + Intronic
923011163 1:230088825-230088847 TAGACAGAAGTGGCCGGGCGCGG - Intronic
923296237 1:232597385-232597407 TAACAAGATTTGGCCGGGCGCGG + Intergenic
924544657 1:245015418-245015440 TATCCAGAATCTGCCGGGCGCGG + Intronic
924788957 1:247226232-247226254 AATCAATATCTGGCCGGGCGCGG - Intergenic
1063244084 10:4200801-4200823 TAGACAAAGCAGGCCGGGCGTGG + Intergenic
1063616368 10:7603871-7603893 TACCCATATCAGGCCGGGCGTGG - Intronic
1064067796 10:12197665-12197687 AATCTAGTTCTGGCCGGGCGCGG - Intronic
1064182069 10:13126568-13126590 TACGAAGTGCTGGCCGGGCGCGG - Intronic
1064260797 10:13784696-13784718 TATCCATAATTGGCCAGGCGCGG + Intronic
1064659990 10:17597426-17597448 TATCCATTGCAGGCTGGGCGTGG - Intronic
1065352655 10:24809479-24809501 CATAGAAAGCTGGCCGGGCGCGG - Intergenic
1065389133 10:25164284-25164306 TATCCAGAACAGGCCTGGCATGG - Intergenic
1065802484 10:29365529-29365551 AACCTAGAGGTGGCCGGGCGCGG - Intergenic
1066329482 10:34404374-34404396 TATACAGTACTGGCCGGGTGAGG + Intronic
1067361081 10:45579721-45579743 TATCCACACCAGGCCAGGCGTGG + Intronic
1067404773 10:46011563-46011585 TATGCAGACAGGGCCGGGCGTGG - Intronic
1067677980 10:48403167-48403189 AATTCAGAGCAAGCCGGGCGCGG + Intronic
1067934491 10:50597720-50597742 TTCACAGAACTGGCCGGGCGTGG + Intronic
1067970649 10:50966388-50966410 AAGCCAGGCCTGGCCGGGCGCGG - Intergenic
1068710464 10:60127985-60128007 TATGAAGAACTGGCCGGGCGCGG - Intronic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1069440701 10:68425689-68425711 GTTCCAGAGATGGCCGGGCGCGG - Intronic
1069458182 10:68570393-68570415 TATCCGGTACTGGCTGGGCGCGG - Intronic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069539565 10:69283488-69283510 AATAAAGAGCTGGCTGGGCGTGG + Intronic
1069560965 10:69429101-69429123 GTTCCAGAGCTGGCTGGGTGCGG + Intergenic
1069923604 10:71832738-71832760 TATCAAGAGAGGGCCGGGCCGGG + Intronic
1070124286 10:73607969-73607991 TATTCAGATTTGGCCGGGCACGG + Intronic
1070498631 10:77049052-77049074 TATCACGTTCTGGCCGGGCGCGG - Intronic
1071917589 10:90312622-90312644 TACCCAGAAATGGCCAGGCGCGG - Intergenic
1071980253 10:90998334-90998356 TACCCAGAGCTGTCCTGGCATGG + Intergenic
1072703379 10:97661279-97661301 AATCCAGCAGTGGCCGGGCGCGG - Intronic
1072875479 10:99168902-99168924 TGTCCTGACCTGGCCGGGCATGG + Intronic
1072970865 10:100016231-100016253 TATCCTGACTTGGCCGGGTGTGG - Intergenic
1073116687 10:101095454-101095476 TGTCCAGAGCTGGAGAGGCGAGG - Intronic
1073246122 10:102091449-102091471 AATCCTGATCGGGCCGGGCGCGG - Intergenic
1073343500 10:102764102-102764124 AATACAGAGAAGGCCGGGCGTGG - Intronic
1073430274 10:103481481-103481503 ATTGCAGATCTGGCCGGGCGTGG + Intergenic
1073752431 10:106544170-106544192 TATTAAGAACTGGCCGGGCCTGG + Intergenic
1074410029 10:113220332-113220354 AACCAAGAGCTGGCCGAGCGCGG - Intergenic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075103538 10:119522426-119522448 TAAAAAGAACTGGCCGGGCGCGG + Intronic
1075112747 10:119600932-119600954 TGTTCATAGCTGGCTGGGCGTGG - Intergenic
1075127910 10:119715533-119715555 TACAAAGAGTTGGCCGGGCGCGG - Intergenic
1075621257 10:123929805-123929827 GATCCAGAGCTGGCAGGGGCGGG - Intronic
1075642823 10:124076997-124077019 TATTAAGAATTGGCCGGGCGCGG - Intronic
1076028297 10:127135251-127135273 CAGCCAGAGCTGGCCTGGCTTGG - Intronic
1077517976 11:3013558-3013580 TAGCAAGTGCTGGCTGGGCGCGG + Intronic
1077815962 11:5685580-5685602 TATCTGGAGAGGGCCGGGCGCGG + Intronic
1079013317 11:16847380-16847402 CAGCCACAGTTGGCCGGGCGTGG - Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079642155 11:22819479-22819501 TAGCCAATGCAGGCCGGGCGCGG + Exonic
1080363087 11:31539172-31539194 TACCTAGTTCTGGCCGGGCGCGG + Intronic
1080437606 11:32260358-32260380 AATGCAGCACTGGCCGGGCGCGG - Intergenic
1081246875 11:40777976-40777998 AATCAAGATCTGGCCGGGAGCGG - Intronic
1081518058 11:43853046-43853068 AACCCAGAGACGGCCGGGCGCGG + Intronic
1081616547 11:44594797-44594819 TTTCCAGAGCCGACCGGGCCGGG + Intronic
1081999232 11:47384034-47384056 TACACAGAGGGGGCCGGGCGTGG + Intergenic
1082010413 11:47446613-47446635 TACCCAGGGTTGGCCGGGTGCGG + Intronic
1082107937 11:48241006-48241028 TGCACAGATCTGGCCGGGCGCGG - Intergenic
1082805510 11:57446941-57446963 AACCCAGCCCTGGCCGGGCGCGG - Intergenic
1082875529 11:57984544-57984566 TATCCAGAGCAGGCTGGAAGAGG + Intergenic
1083101411 11:60310300-60310322 TATTAACAGTTGGCCGGGCGCGG - Intergenic
1083227967 11:61296324-61296346 AAACCACAGGTGGCCGGGCGCGG + Intergenic
1083488487 11:62998240-62998262 TAGTCAGAGCTGGCCGGGCACGG - Intronic
1083794927 11:65010687-65010709 TAAACATAGTTGGCCGGGCGCGG + Intergenic
1083797937 11:65028801-65028823 TTCCCAGTGGTGGCCGGGCGCGG + Intronic
1083816913 11:65138110-65138132 TAGCCAGGCGTGGCCGGGCGTGG + Intergenic
1084203741 11:67578790-67578812 TATCTTAAGCTGGCCGGGCACGG + Intergenic
1084507331 11:69576352-69576374 TACCCGGAGATGGCCGGGCTGGG - Intergenic
1084738153 11:71119289-71119311 TCTCCAGCACTGGCCGGGTGCGG + Intronic
1085097375 11:73772338-73772360 TACCCATATCTGGCCGGGCGCGG - Intergenic
1085281277 11:75332604-75332626 TACCTATAGCTGGCCAGGCGCGG + Intronic
1085333703 11:75673545-75673567 AATGCAAAGATGGCCGGGCGCGG + Intergenic
1085519034 11:77127416-77127438 CACCCAGAGCTGCCCTGGCGAGG + Intergenic
1085629941 11:78106485-78106507 AAACCTGGGCTGGCCGGGCGCGG - Intronic
1085639739 11:78185880-78185902 TAGGCAGACCTGGCCGGGCGCGG - Intronic
1086262062 11:84952253-84952275 AAACCAGAACTGGCCGGGCGCGG + Intronic
1086373572 11:86178279-86178301 GATCCTGATCTGGCCGGGCGTGG + Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1086774314 11:90810981-90811003 AAACCAAAGTTGGCCGGGCGCGG - Intergenic
1087050943 11:93885785-93885807 AAGCTAGAACTGGCCGGGCGTGG - Intergenic
1087244164 11:95814648-95814670 TACACAAGGCTGGCCGGGCGTGG - Intronic
1087795548 11:102452379-102452401 GACCCAGAGGTGACCGGGCGGGG - Intronic
1088867858 11:113866005-113866027 TATACAGTGCTGGCCGGGCACGG + Intronic
1089944201 11:122451150-122451172 TTTATAGAGCTGGCCTGGCGCGG + Intergenic
1090003136 11:122979092-122979114 TACCTACACCTGGCCGGGCGCGG - Intronic
1090035486 11:123246222-123246244 AATGCAGAGCTGGCCGGGCACGG - Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1091570339 12:1679880-1679902 TAGTCAGTTCTGGCCGGGCGCGG + Intergenic
1091631027 12:2161108-2161130 TAACCAGAGCTAGCCGGGTGCGG - Intronic
1091872559 12:3906601-3906623 TACCCAAACATGGCCGGGCGCGG - Intergenic
1091941952 12:4493800-4493822 TGTCTACAGCTGGCCGGGAGTGG + Intronic
1092139898 12:6176473-6176495 TAGCCAGGTGTGGCCGGGCGCGG + Intergenic
1092146945 12:6221350-6221372 TATGCCCAGCTGGTCGGGCGGGG - Intronic
1092373835 12:7939138-7939160 GATCAAGAGATCGCCGGGCGCGG - Intergenic
1092603290 12:10090552-10090574 TACCTAGAATTGGCCGGGCGCGG - Intronic
1093017526 12:14170191-14170213 TACACAGACTTGGCCGGGCGCGG + Intergenic
1093060318 12:14595384-14595406 TAACCAGAGATGGCCGGGCGTGG - Intergenic
1093972820 12:25390823-25390845 TATCCAGTACCAGCCGGGCGCGG + Intergenic
1094573186 12:31659856-31659878 AAGCCGAAGCTGGCCGGGCGTGG + Intronic
1094679861 12:32658504-32658526 AATAGAGATCTGGCCGGGCGCGG + Intergenic
1094818166 12:34206019-34206041 TAGCCAGAGCAGGGCGGGCCAGG + Intergenic
1095862916 12:46939123-46939145 TATAAACACCTGGCCGGGCGCGG + Intergenic
1096313268 12:50540825-50540847 TGTTCATAGCTGGCTGGGCGCGG - Intronic
1096678780 12:53241391-53241413 AATACAAAACTGGCCGGGCGTGG - Intergenic
1096732122 12:53622328-53622350 TAGAAATAGCTGGCCGGGCGTGG + Intronic
1097064269 12:56309258-56309280 TAGCCAGTGCAGGCCGGGCGCGG + Intronic
1097211545 12:57374397-57374419 TGACCAGACCAGGCCGGGCGTGG + Intronic
1097252551 12:57644376-57644398 GATACAGAGAGGGCCGGGCGTGG - Intergenic
1097359041 12:58637565-58637587 AACCCAGAGCTGGCCGGGCACGG + Intronic
1097631706 12:62072172-62072194 AATCCATTCCTGGCCGGGCGCGG + Intronic
1098403452 12:70098403-70098425 TCTCCAAAAGTGGCCGGGCGCGG - Intergenic
1098796731 12:74898296-74898318 TAGGCAGAACTGGCCGGGCGCGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1101105031 12:101432291-101432313 TCTTTATAGCTGGCCGGGCGCGG + Intergenic
1101653706 12:106700694-106700716 TATACAAACTTGGCCGGGCGCGG - Intronic
1101678714 12:106943591-106943613 AAACCAGAGCAGGCCGGGCGCGG - Intergenic
1101853413 12:108422662-108422684 TATCCAGTCTTGGCCGGGTGTGG - Intergenic
1102057773 12:109909672-109909694 TAGCCGGACATGGCCGGGCGTGG + Intronic
1102130659 12:110526124-110526146 AATCCACAGCAGGCCAGGCGGGG - Intronic
1103096083 12:118133515-118133537 TAGCCAGGCGTGGCCGGGCGCGG - Intronic
1103324829 12:120113526-120113548 AATACAGAACTGGCCGGGCGCGG + Intronic
1103582614 12:121926652-121926674 TATTCAGTGTTGGCCGGGCGCGG + Intronic
1103725158 12:122994161-122994183 AATGCAGAGCTGGCCGGGCGCGG - Intronic
1103796018 12:123503709-123503731 TCTCAAGATCTGGCCGGGAGTGG + Intronic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104467563 12:129003311-129003333 AAAACAGGGCTGGCCGGGCGCGG + Intergenic
1104638214 12:130450874-130450896 GACGCAGAGCTGGCCGGGAGGGG - Intronic
1104753770 12:131256210-131256232 AAGCCAGTTCTGGCCGGGCGCGG - Intergenic
1104886213 12:132110350-132110372 CATTCAGAGTTGGCCGGGCACGG + Intronic
1105593481 13:21815073-21815095 AATCAGGAGATGGCCGGGCGGGG + Intergenic
1105684285 13:22762946-22762968 AAACCAAAACTGGCCGGGCGCGG - Intergenic
1105742492 13:23342075-23342097 TTTCCAGTACTGGCCGGGCGTGG - Intronic
1106304987 13:28501404-28501426 AGACCTGAGCTGGCCGGGCGCGG - Intergenic
1106642908 13:31604679-31604701 TATCCAGCCTTGGCCAGGCGCGG + Intergenic
1106743711 13:32676639-32676661 AAACAAGATCTGGCCGGGCGCGG + Intronic
1107009404 13:35652982-35653004 CTGCCAGAGGTGGCCGGGCGCGG - Intronic
1107781066 13:43902546-43902568 AGGCCAAAGCTGGCCGGGCGCGG - Intergenic
1108471047 13:50767163-50767185 ACTCCAGACGTGGCCGGGCGCGG + Intronic
1108667533 13:52647707-52647729 ATCCCAGAGCTGGCTGGGCGCGG - Intergenic
1110047872 13:70854194-70854216 TCTCAAGAGCCGGCTGGGCGCGG - Intergenic
1110270689 13:73586662-73586684 TAGCCAGAGATGGCCGGGAGTGG + Intergenic
1110976808 13:81847670-81847692 TATACAGTTTTGGCCGGGCGCGG - Intergenic
1110982002 13:81911990-81912012 TTTCCAATGTTGGCCGGGCGCGG + Intergenic
1111131632 13:83984185-83984207 TGTCCTAGGCTGGCCGGGCGCGG - Intergenic
1112583258 13:100694651-100694673 TATCCAGAGCTTGCCCTGCTGGG + Intergenic
1113009581 13:105748403-105748425 TCTCCAGCAGTGGCCGGGCGCGG - Intergenic
1113461480 13:110485231-110485253 TTTGCAGCACTGGCCGGGCGCGG + Intronic
1114181013 14:20367897-20367919 TACCCAGAGGAGGCCGGGCATGG - Exonic
1114518670 14:23319379-23319401 TGTGCAGGGCTGGCTGGGCGTGG - Intronic
1114858934 14:26491138-26491160 TAGCCAGATGTGGCCGGGCACGG - Intronic
1115294794 14:31813275-31813297 TAACCAGAGCTGGCTGGGCACGG - Intronic
1115550928 14:34504549-34504571 AAGACAGAGCTGGCCGGGCGCGG + Intergenic
1116007729 14:39314093-39314115 TACCCACATCTGGCCGGGCATGG + Intronic
1116372710 14:44156248-44156270 TAAAAAGATCTGGCCGGGCGCGG + Intergenic
1116483517 14:45419253-45419275 TATTGAAATCTGGCCGGGCGCGG - Intergenic
1117255863 14:53976763-53976785 TATTCAGAACTGGCTGGGCGCGG + Intergenic
1117351118 14:54883081-54883103 GACCCACTGCTGGCCGGGCGCGG + Intronic
1117500495 14:56346435-56346457 TATTTACAGTTGGCCGGGCGTGG + Intergenic
1118110094 14:62708953-62708975 TATCCTCTGTTGGCCGGGCGCGG + Intronic
1118215641 14:63805661-63805683 TCTACAGTGATGGCCGGGCGCGG - Intergenic
1118360230 14:65050303-65050325 TAACTAAAGCTGGCCGGGCGTGG + Intronic
1118690175 14:68331071-68331093 GAACAATAGCTGGCCGGGCGCGG + Intronic
1118726474 14:68632568-68632590 CATTCACAGCTGGCCTGGCGGGG - Intronic
1119184681 14:72631613-72631635 TATCCTAAGCTGGCTGGGTGTGG - Intronic
1119210338 14:72826750-72826772 CATTCACAGATGGCCGGGCGCGG + Intronic
1119810450 14:77513601-77513623 AAGTCAAAGCTGGCCGGGCGCGG + Intronic
1120610730 14:86637924-86637946 TAGACAAATCTGGCCGGGCGCGG + Intergenic
1121355872 14:93214215-93214237 TATCCAGTTTTGGCTGGGCGTGG - Intronic
1121426381 14:93855076-93855098 AATACAGAACTGGCCGGGTGTGG + Intergenic
1121559853 14:94866338-94866360 AAGACAGAGCTGGCTGGGCGCGG + Intergenic
1122589008 14:102832381-102832403 TATCAAGCACTGGCCGGGCGTGG + Intronic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1123425361 15:20166561-20166583 AATCCAGAGTGGGCCGGGCATGG + Intergenic
1123534584 15:21173093-21173115 AATCCAGAGTGGGCCGGGCATGG + Intergenic
1123628254 15:22242564-22242586 AACCCAGACCAGGCCGGGCGTGG - Intergenic
1123737137 15:23196222-23196244 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124082594 15:26515797-26515819 TACCCAGCACAGGCCGGGCGCGG + Intergenic
1124183294 15:27498794-27498816 AACCCACATCTGGCCGGGCGTGG - Intronic
1124288353 15:28424887-28424909 TACCCTGTGCAGGCCGGGCGCGG - Intergenic
1124294871 15:28492427-28492449 TACCCTGTGCAGGCCGGGCGCGG + Intergenic
1124379660 15:29154990-29155012 TAGGCAGAACCGGCCGGGCGTGG + Intronic
1125479222 15:40069196-40069218 ACTCCAGGGCTGGCCGGGCCAGG - Intergenic
1125847862 15:42874695-42874717 GTTCCAGAAGTGGCCGGGCGCGG + Intronic
1125955364 15:43787287-43787309 AACCCAGGCCTGGCCGGGCGTGG - Intronic
1126009878 15:44292484-44292506 TATACAGAACTAGCCGGGTGCGG - Intronic
1126059178 15:44762254-44762276 TAGCCAGAGATGGCCAGGTGCGG - Intronic
1126763876 15:51994248-51994270 AACCAAGAGCTGGCCAGGCGCGG - Intronic
1126809722 15:52389660-52389682 AAACAAAAGCTGGCCGGGCGTGG + Intronic
1127045136 15:55017513-55017535 GACCCTGAGCCGGCCGGGCGCGG - Intergenic
1127106561 15:55622679-55622701 TAGCCAGGTGTGGCCGGGCGCGG - Intronic
1127495921 15:59512186-59512208 TATGCAATGCTGGCCAGGCGAGG + Intronic
1127857267 15:62962801-62962823 GTTCCAGAGCTGGCCGGGGCCGG + Intergenic
1127941006 15:63695676-63695698 TATACAGACTCGGCCGGGCGTGG - Intronic
1128193634 15:65728777-65728799 TAGCCAAAGGGGGCCGGGCGCGG - Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128425768 15:67541536-67541558 TAACCAAGGTTGGCCGGGCGCGG + Intergenic
1128475614 15:67994621-67994643 TATGCACTGGTGGCCGGGCGTGG + Intergenic
1128876551 15:71206300-71206322 TCTCCAAACGTGGCCGGGCGCGG - Intronic
1128968411 15:72085102-72085124 TACCTGCAGCTGGCCGGGCGTGG + Intronic
1129150032 15:73682875-73682897 TATACACACCCGGCCGGGCGCGG + Intergenic
1129315777 15:74742897-74742919 TATCCAGTGGTGGCCAGGTGTGG + Intergenic
1129349713 15:74948380-74948402 AACCCAGAGGAGGCCGGGCGCGG + Intergenic
1129536853 15:76320304-76320326 TGTCCATAGCAGGCTGGGCGTGG + Intergenic
1129693853 15:77729462-77729484 AATCCAGAGCTGGGAGGGCTGGG + Intronic
1129873718 15:78958462-78958484 ATTCTAGAGCAGGCCGGGCGTGG - Intergenic
1130385002 15:83403488-83403510 TATCCAGCCCAGGCCAGGCGCGG + Intergenic
1130828917 15:87579762-87579784 TGTCTAGAGCTGGCGGGGGGAGG + Intergenic
1130834727 15:87638753-87638775 TAGCCAGGGCTGGCCAGGCTGGG + Intergenic
1130962706 15:88673858-88673880 TATGAAGATATGGCCGGGCGAGG - Intergenic
1131009250 15:89003709-89003731 TCTCCACAGGTGGCCAGGCGCGG - Intergenic
1131515396 15:93073297-93073319 TAGCCGGAGGCGGCCGGGCGGGG + Intronic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1131578093 15:93612348-93612370 AATCCATAATTGGCCGGGCGCGG - Intergenic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132533505 16:465893-465915 GAACCACTGCTGGCCGGGCGCGG - Intronic
1132795615 16:1720324-1720346 TATAAAAAGCTGGCCGGGCACGG - Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1132943969 16:2522072-2522094 TAACAAAAACTGGCCGGGCGCGG - Intronic
1133010237 16:2906452-2906474 AATCCAAAACTAGCCGGGCGTGG + Intergenic
1133409163 16:5553603-5553625 TATTCAGACATGGCTGGGCGTGG - Intergenic
1133538554 16:6725339-6725361 TAGCCAAAACCGGCCGGGCGCGG - Intronic
1134272807 16:12748593-12748615 TATGCAAGACTGGCCGGGCGCGG + Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134543000 16:15084004-15084026 GTTCCAGTTCTGGCCGGGCGCGG - Intronic
1134906177 16:17981752-17981774 AATCTATTGCTGGCCGGGCGTGG + Intergenic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1135035203 16:19071424-19071446 AATCCACACCTGTCCGGGCGCGG - Intronic
1135360591 16:21810137-21810159 GTTCCAGTTCTGGCCGGGCGCGG - Intergenic
1136127824 16:28197624-28197646 TATTCAGACTAGGCCGGGCGCGG + Intronic
1136262233 16:29086890-29086912 GTTCCAGTTCTGGCCGGGCGCGG + Intergenic
1136591045 16:31217901-31217923 TGTCCCCTGCTGGCCGGGCGTGG - Intronic
1136859504 16:33689166-33689188 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1136997275 16:35199018-35199040 TCTCCAGCGCTGACCCGGCGGGG - Intergenic
1137250995 16:46740840-46740862 TTTCCATCTCTGGCCGGGCGTGG - Intronic
1138388703 16:56654255-56654277 GATTCAGAGCCGGCTGGGCGCGG - Intronic
1138905109 16:61322522-61322544 TATCTGTAGGTGGCCGGGCGCGG + Intergenic
1139172336 16:64647176-64647198 TATCTCGACCTGGCAGGGCGCGG - Intergenic
1139250027 16:65486406-65486428 TAAACTGAACTGGCCGGGCGCGG - Intergenic
1139525178 16:67511258-67511280 TAGCCAGAAGTGGCCAGGCGCGG - Intergenic
1139818279 16:69695551-69695573 AATACAGACCAGGCCGGGCGTGG + Intronic
1139873064 16:70123190-70123212 TATCCACTGCGGGCCGGGCACGG - Intronic
1139895054 16:70281859-70281881 TAATAATAGCTGGCCGGGCGTGG + Intronic
1139913480 16:70413423-70413445 AATAAAAAGCTGGCCGGGCGCGG + Intronic
1140239597 16:73189150-73189172 TACCCAGATGTGGGCGGGCGCGG - Intergenic
1141122548 16:81371757-81371779 TATCCAGAGCTGCCCCAGTGAGG + Intronic
1141718376 16:85740410-85740432 TATCCAGGTGTGGCCGGGCGCGG + Intronic
1141924458 16:87158716-87158738 GAACAAGAGCTGGCCGGGTGTGG + Intronic
1141975691 16:87514760-87514782 AACCCAGACCAGGCCGGGCGTGG + Intergenic
1142329389 16:89441475-89441497 TACGCAAACCTGGCCGGGCGCGG + Intronic
1142520431 17:500774-500796 TGTCGCTAGCTGGCCGGGCGTGG - Intergenic
1142578152 17:922940-922962 AATGCAGAGTGGGCCGGGCGTGG - Intronic
1142659486 17:1417947-1417969 AAAACAGAGCAGGCCGGGCGCGG - Intergenic
1142742391 17:1938758-1938780 AATACAGACATGGCCGGGCGCGG + Intronic
1142748582 17:1973746-1973768 TAAAAAGAGCTGGCCGGGTGTGG + Intronic
1142760539 17:2039665-2039687 TCCACAGGGCTGGCCGGGCGCGG - Intronic
1142771913 17:2104239-2104261 TAGCCAGGTGTGGCCGGGCGCGG - Intronic
1142832231 17:2557858-2557880 ACTCCTGTGCTGGCCGGGCGCGG - Intergenic
1142971096 17:3612092-3612114 AATGCAGAGCTGGCGGGGCATGG - Intronic
1143403871 17:6663516-6663538 TGTCCAAACCTGGCCAGGCGCGG - Intergenic
1143438995 17:6953361-6953383 AATCAGGTGCTGGCCGGGCGCGG - Intronic
1143526069 17:7473403-7473425 TATCCGGGCCTGGCCAGGCGCGG - Intronic
1143643375 17:8213027-8213049 TAGCCAGTTCTGGCCAGGCGCGG + Intergenic
1143762995 17:9118227-9118249 TATACAGTTCAGGCCGGGCGCGG + Intronic
1144087832 17:11826750-11826772 CATACAGAACTGGCTGGGCGCGG - Intronic
1144296404 17:13879132-13879154 TAAGAATAGCTGGCCGGGCGCGG + Intergenic
1144487541 17:15679645-15679667 TAGGCCAAGCTGGCCGGGCGTGG + Intronic
1144701099 17:17340812-17340834 AAACAAGAGCAGGCCGGGCGCGG - Intronic
1144704039 17:17355746-17355768 TATCCAGAGCTGCCCAGGCCTGG + Intergenic
1144745721 17:17612992-17613014 AAGGTAGAGCTGGCCGGGCGCGG + Intergenic
1144995693 17:19266690-19266712 AATGCTGAGATGGCCGGGCGTGG - Intronic
1145092298 17:19995905-19995927 GAGCCAGAGTTGGCCAGGCGTGG - Intergenic
1145996841 17:29109800-29109822 TTTCCAGAGCTGGCCCTGCCCGG - Intronic
1146208990 17:30927321-30927343 TGTCTAGAGCTGGCCAGGCACGG + Intronic
1146229964 17:31098641-31098663 TCTTAAGAGTTGGCCGGGCGCGG + Intronic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1147191482 17:38740467-38740489 AACCCAGAGTTGGCCGGGCGCGG + Intronic
1147285143 17:39396663-39396685 TATGCAGGTCTTGCCGGGCGTGG + Intronic
1147735254 17:42633363-42633385 AAGCCAGAGGGGGCCGGGCGTGG + Intergenic
1148812069 17:50299672-50299694 TATCCAAGGCTGGCCAGGTGTGG - Intergenic
1149718783 17:58821398-58821420 AATACAAAGCTGGCCGGGCGCGG - Intronic
1149743821 17:59075271-59075293 TATACAGAGAAGGCCGGGCACGG + Intronic
1149808717 17:59644839-59644861 TAGGAAGAGCTGGCTGGGCGTGG - Intronic
1150279926 17:63923846-63923868 TATATATACCTGGCCGGGCGCGG - Intergenic
1150673518 17:67223458-67223480 TATCCAAACTTGGCCGGGCGTGG + Intronic
1150911309 17:69390387-69390409 TACGAGGAGCTGGCCGGGCGTGG - Intergenic
1150932696 17:69602424-69602446 TACCCAAATCTGGCCGGGCGCGG - Intergenic
1150991103 17:70260352-70260374 TAGGCAGAGGTGGCCGGGCACGG + Intergenic
1151747830 17:76021344-76021366 TAGACAGAGCTGGCAGGGCGCGG - Intronic
1151796693 17:76351224-76351246 TAGCCAGGTGTGGCCGGGCGCGG + Intronic
1151797453 17:76355791-76355813 TAGCCAGATGTGGCCGGGCGCGG + Intronic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152919681 17:83059678-83059700 AATGCAGATCTGGCCGGGTGCGG + Intergenic
1152986938 18:329780-329802 TATAAAGAGCTGGCCTGGCTAGG + Intronic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1153613504 18:6911122-6911144 TACCAAGAGCTGGCCGAGCGCGG - Intronic
1154364786 18:13698060-13698082 AATTAAGAACTGGCCGGGCGTGG + Intronic
1155408875 18:25519908-25519930 TAGCCAGATGTGGCCGGGCACGG - Intergenic
1155939277 18:31787306-31787328 TGTCCAGGACGGGCCGGGCGCGG - Intergenic
1155948956 18:31887353-31887375 TAGTAAGAGCTGGCTGGGCGTGG + Intronic
1155950056 18:31902022-31902044 TATGCTGAACTGGCCGGGTGTGG + Intronic
1156172346 18:34500752-34500774 AATATAGAACTGGCCGGGCGTGG - Intronic
1156255865 18:35395589-35395611 AACCCATAGCTGGCCAGGCGCGG - Intergenic
1156286960 18:35706218-35706240 TAGAAAGAGCCGGCCGGGCGCGG + Intronic
1158009764 18:52715593-52715615 AATGTAGTGCTGGCCGGGCGTGG - Intronic
1158134295 18:54189510-54189532 TACAAAAAGCTGGCCGGGCGCGG - Intronic
1158301523 18:56058052-56058074 TCCCCAGAGGAGGCCGGGCGCGG - Intergenic
1158612773 18:58957771-58957793 GATTCAGAACTGGCCGGGCATGG + Intronic
1158970895 18:62665449-62665471 TATGCAGAGTTGGCCGGGCGTGG + Intergenic
1158981844 18:62770398-62770420 TAACCAGAGTAGGCCGGGCACGG - Intronic
1159460494 18:68716786-68716808 TAGCCAGATGTGGCCTGGCGCGG + Intronic
1159905484 18:74086698-74086720 TATTCAGTGCTGGCTGGGCATGG - Intronic
1160242835 18:77135424-77135446 TATTCAGTCCTGGCCGGGCGTGG - Intergenic
1160878276 19:1308033-1308055 GACCCAGAGCTTGCCGGGCACGG - Intergenic
1160969937 19:1763071-1763093 TAGCCAGATGTGGCCGGGTGCGG + Intronic
1161007923 19:1945529-1945551 CAGCCAGCTCTGGCCGGGCGCGG + Intronic
1161024684 19:2030838-2030860 TGTGCTGAGGTGGCCGGGCGCGG - Intronic
1161132334 19:2598365-2598387 AATACAGAATTGGCCGGGCGTGG + Intronic
1161182452 19:2893430-2893452 AATACAGAATTGGCCGGGCGTGG + Intergenic
1161239847 19:3216284-3216306 TAGCCAGGCGTGGCCGGGCGCGG + Intergenic
1161276039 19:3417926-3417948 CTTCCAGAGGTGGCCGGGCACGG - Intronic
1161386434 19:3996302-3996324 TACCCAGGTATGGCCGGGCGTGG - Intergenic
1161617554 19:5280426-5280448 TCACTAGACCTGGCCGGGCGTGG + Intronic
1161831766 19:6610655-6610677 TACACAGAGCCGGCCGGGTGCGG - Intergenic
1162129144 19:8514717-8514739 AATAAAGAACTGGCCGGGCGCGG - Intergenic
1162135866 19:8554891-8554913 AAAACAGGGCTGGCCGGGCGCGG + Intronic
1162368433 19:10263851-10263873 TAGCCAGGCATGGCCGGGCGCGG + Intergenic
1162989153 19:14291143-14291165 AATCCAATTCTGGCCGGGCGCGG - Intergenic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1163450015 19:17371461-17371483 TAAAAATAGCTGGCCGGGCGTGG - Intronic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163600692 19:18247584-18247606 TACCCAGAGCTGGCCAGGCGCGG - Intronic
1164000874 19:21097154-21097176 TATCCTGAACAGGCCGGGCGTGG - Intronic
1164537357 19:29095856-29095878 TACCCAGAAATGGCCGGGCACGG - Intergenic
1164645757 19:29857981-29858003 AAACCATAGCTGGCTGGGCGCGG - Intergenic
1164731320 19:30507069-30507091 AATACAGACCTGGCTGGGCGTGG + Intronic
1165557844 19:36650939-36650961 TTCCTAGAGCTGGCCGGGCGTGG + Intronic
1165704332 19:37964786-37964808 TATTAAATGCTGGCCGGGCGCGG - Intronic
1165813807 19:38628666-38628688 AATACAAAGTTGGCCGGGCGTGG + Intronic
1165815962 19:38642421-38642443 TTTCCAGAGCTGGGCTGGAGTGG - Intergenic
1165937128 19:39396148-39396170 TACCTAGAGCTGGTCAGGCGCGG + Intronic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1166396121 19:42442522-42442544 TATCTGCAACTGGCCGGGCGCGG - Intronic
1166760599 19:45221938-45221960 AAAACAGAGCTGGCCGGGCGTGG - Intronic
1166836771 19:45671910-45671932 AATCCTGTGGTGGCCGGGCGCGG - Intronic
1166854437 19:45776431-45776453 TAGGCTGGGCTGGCCGGGCGTGG - Intronic
1166945456 19:46393542-46393564 CATCCAGGGCTGGCCGGGCACGG + Intergenic
1167446090 19:49538455-49538477 TAGCCAGGCATGGCCGGGCGTGG - Intronic
1167511940 19:49899843-49899865 TAGCCAGGTGTGGCCGGGCGAGG - Intronic
1167678375 19:50903663-50903685 GAAAAAGAGCTGGCCGGGCGTGG - Intergenic
1167697000 19:51020657-51020679 GATCCTGAGCTGGCCGGGCGCGG + Intergenic
1167868798 19:52350385-52350407 TATACAGCATTGGCCGGGCGTGG + Intronic
1167876512 19:52418271-52418293 TATGCTGAGCTGGCCAGGTGTGG - Exonic
1168045879 19:53793873-53793895 TTGACAGAGCTGGCCAGGCGTGG - Exonic
1168621515 19:57883066-57883088 TAAACAGAACTGGCCGGGTGTGG + Intronic
1168646258 19:58060834-58060856 AACCCAGATTTGGCCGGGCGCGG + Intronic
1168656706 19:58134643-58134665 AACACAGAGCAGGCCGGGCGCGG + Intronic
926035948 2:9635796-9635818 TATCCATATCTGGCCAGGCGTGG - Intergenic
926268992 2:11350931-11350953 TTAGCAGAGTTGGCCGGGCGCGG + Intergenic
927169932 2:20360890-20360912 TGTCCAAAGCTGGCTGGGCGTGG + Intergenic
927500553 2:23580078-23580100 AATCTAGACCAGGCCGGGCGCGG + Intronic
927682409 2:25148630-25148652 ACTTCAGAACTGGCCGGGCGCGG + Intronic
927947016 2:27141246-27141268 AACCCACAGCCGGCCGGGCGTGG - Intergenic
928163470 2:28951123-28951145 AATTCAAATCTGGCCGGGCGTGG - Intergenic
928611933 2:32999599-32999621 GATCCAGAGGCGGCTGGGCGCGG + Intronic
930053036 2:47231204-47231226 AACCTAGAGCTGGCCAGGCGTGG - Intergenic
930493644 2:52109760-52109782 AGTAAAGAGCTGGCCGGGCGCGG + Intergenic
930549072 2:52809036-52809058 TAGGCAGACTTGGCCGGGCGCGG + Intergenic
931210058 2:60184608-60184630 AATCTACACCTGGCCGGGCGCGG + Intergenic
931349591 2:61475324-61475346 TATACACACTTGGCCGGGCGCGG - Intergenic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
932241245 2:70158736-70158758 TAGCCAGGCGTGGCCGGGCGTGG - Intronic
932804684 2:74773589-74773611 TTACCAGTGTTGGCCGGGCGCGG + Intergenic
934457862 2:94190286-94190308 AATCCAGAGTGGGCCGGGCATGG - Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
935016492 2:99187533-99187555 TATCCACACCCGGCTGGGCGCGG + Intronic
935113670 2:100114670-100114692 AATGCAGGGCTGGCCAGGCGTGG - Intronic
935375365 2:102390641-102390663 AACCCCCAGCTGGCCGGGCGCGG + Intronic
935408072 2:102730338-102730360 GATCCAGAGGTGGCCAGGCATGG - Intronic
936559488 2:113524350-113524372 TATACAAAGCTGGCAGGGCCGGG - Intergenic
936692052 2:114901484-114901506 TATCCATTTGTGGCCGGGCGCGG - Intronic
937493771 2:122396867-122396889 TATCAAAAACTGGCCGGGCTCGG - Intergenic
937970383 2:127544868-127544890 TAGCCAGACGTGGCCGGGCGCGG - Intronic
940226819 2:151409536-151409558 GACTAAGAGCTGGCCGGGCGCGG - Intergenic
940649377 2:156426211-156426233 TACCCAGACTTGGCCGGGCGTGG - Intergenic
940918100 2:159280399-159280421 TACCCAGAAGTGGCCGGGCGCGG + Intronic
941817631 2:169813562-169813584 TACCTAAAACTGGCCGGGCGCGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941834072 2:169996987-169997009 AATCCAAAGCAGGCCGGGCATGG - Intronic
941897779 2:170646684-170646706 TAAACAGAGCTGGCTGGGCACGG - Intronic
942044209 2:172090073-172090095 TCTCAAGAGCTGGCTGGGTGTGG - Intergenic
943438902 2:187901758-187901780 TAGCCAGGGCAGGCCGGGCGCGG + Intergenic
943712048 2:191107998-191108020 TATCCATTGTTGGCCGGGTGCGG + Intronic
943850101 2:192708691-192708713 TTTCCAGAGAGGGCTGGGCGCGG - Intergenic
943923784 2:193744620-193744642 TATGAATACCTGGCCGGGCGCGG + Intergenic
944778219 2:202991111-202991133 GATAAAGAACTGGCCGGGCGCGG + Intronic
945081238 2:206088036-206088058 AATCCAGAATAGGCCGGGCGCGG - Intergenic
946407020 2:219497224-219497246 TGCCCAGAGCTGGGCTGGCGGGG - Intronic
947417863 2:229917088-229917110 TACCAAGCACTGGCCGGGCGCGG + Intronic
947589786 2:231379087-231379109 TGTGCACAGCTGGCCGGGCACGG + Intergenic
947636254 2:231681968-231681990 TTAAAAGAGCTGGCCGGGCGCGG + Intergenic
947662328 2:231878897-231878919 TACTCCGGGCTGGCCGGGCGTGG + Intergenic
947814968 2:233030636-233030658 TGTCCTCAGCTGGCCGGGCGTGG + Intergenic
948255752 2:236567287-236567309 AATGCAGACCCGGCCGGGCGCGG - Intergenic
1168760649 20:347594-347616 CGTCCAGCGCTGCCCGGGCGGGG - Intronic
1168790315 20:571903-571925 CATCCACAGCTGGCCGGCCAGGG - Intergenic
1169223446 20:3840842-3840864 GAGCCAGTGGTGGCCGGGCGCGG + Intergenic
1169272491 20:4211328-4211350 TATTCAGAGCTAGCTGGGAGCGG + Intergenic
1170692219 20:18625937-18625959 TCTCCAGAGCTGGCCCTGTGTGG - Intronic
1171225790 20:23441047-23441069 GAAAAAGAGCTGGCCGGGCGTGG - Intronic
1172081420 20:32344030-32344052 TAGCCTGGGCTGGCCAGGCGTGG + Intergenic
1172230885 20:33334933-33334955 TAATCAGAGATGGCTGGGCGCGG + Intergenic
1172614242 20:36273044-36273066 TGTGAAGAGCTGGCCGGGCATGG + Intergenic
1172636507 20:36413707-36413729 TGTCCAGAATAGGCCGGGCGCGG - Intronic
1173493710 20:43503919-43503941 AATTCATTGCTGGCCGGGCGCGG - Intergenic
1173542327 20:43863433-43863455 TGTCCTGAGACGGCCGGGCGCGG - Intergenic
1173840924 20:46156603-46156625 TATCCACTGCTGGCCAGGCGCGG - Intergenic
1174079246 20:47959306-47959328 TATCTATAGTGGGCCGGGCGCGG - Intergenic
1174195956 20:48772974-48772996 TGTCCATAACTGGCCAGGCGCGG + Intronic
1174245761 20:49178781-49178803 TAGCCAGGCATGGCCGGGCGCGG + Intronic
1174318641 20:49722706-49722728 TATCAAGTACTGGCCGGGCATGG + Intergenic
1174363676 20:50043735-50043757 GAGGCAGAGCCGGCCGGGCGCGG - Intergenic
1174608268 20:51777381-51777403 TACCCACAACAGGCCGGGCGCGG + Intergenic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1176217051 20:63952957-63952979 TAGGCACAGGTGGCCGGGCGCGG + Intronic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1177179760 21:17732244-17732266 TAGCCAGGTGTGGCCGGGCGCGG - Intergenic
1177369234 21:20180123-20180145 AGCCAAGAGCTGGCCGGGCGCGG - Intergenic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178325768 21:31644312-31644334 TATCCAGTTTAGGCCGGGCGTGG + Intergenic
1178677734 21:34645484-34645506 AACCCTGAGTTGGCCGGGCGTGG + Intergenic
1178941659 21:36911776-36911798 TAAACAGAGAGGGCCGGGCGCGG + Intronic
1178949115 21:36971536-36971558 TTTCAAGAGCCGGCTGGGCGCGG + Intronic
1178987340 21:37318125-37318147 AATCCAAAACTGGCCGGGCGCGG + Intergenic
1179207478 21:39295475-39295497 TAGACATACCTGGCCGGGCGCGG - Intronic
1179892540 21:44344090-44344112 AAATCAGAGCTGGCCAGGCGTGG + Intergenic
1179954886 21:44733083-44733105 CATCCTGAGCTGGGAGGGCGGGG - Intergenic
1180180037 21:46114134-46114156 AATCCACACTTGGCCGGGCGTGG + Intronic
1180224268 21:46380448-46380470 TACCCAGGGTTGGCCGGGCGCGG - Intronic
1180558753 22:16598679-16598701 TAACCAGGCCTGGCTGGGCGCGG - Intergenic
1180736297 22:18020101-18020123 CATCAGCAGCTGGCCGGGCGCGG - Intronic
1180747045 22:18096706-18096728 AAATCAGAGCCGGCCGGGCGTGG - Exonic
1180873247 22:19159852-19159874 AAAACAGTGCTGGCCGGGCGCGG - Intergenic
1181481445 22:23201743-23201765 AACCCAGACTTGGCCGGGCGCGG - Intronic
1181828244 22:25537474-25537496 TACCCAAAGGAGGCCGGGCGCGG + Intergenic
1182092035 22:27602531-27602553 TATCCAGAGGTGGGCGGGGCTGG + Intergenic
1182176485 22:28294855-28294877 TGTCAAGAGCTGGCCAGGCACGG - Intronic
1182237629 22:28888825-28888847 AACCCAGGTCTGGCCGGGCGCGG + Intronic
1182306756 22:29375058-29375080 TAGGCAGTTCTGGCCGGGCGCGG + Intronic
1182361023 22:29746574-29746596 AATCCAGAGCAGGCAGGGCATGG - Intronic
1182573543 22:31257180-31257202 GATCCATAGCTCGCTGGGCGGGG - Intronic
1182641846 22:31774548-31774570 TAAGCAGAGCTGGCTGGGTGCGG + Intronic
1182745562 22:32603220-32603242 AACACAGCGCTGGCCGGGCGCGG + Intronic
1182883589 22:33754624-33754646 AATGAAGAGCTGGCCGGGCACGG - Intronic
1183067508 22:35373180-35373202 TATTTTGAGCTGGCCAGGCGTGG + Intergenic
1183788910 22:40049089-40049111 TATACACTGCTGGCTGGGCGCGG + Intronic
1183923407 22:41187470-41187492 TCAACAGAGTTGGCCGGGCGCGG + Intergenic
1184245369 22:43233072-43233094 TAATCAGTGCTGGCCGGGCACGG + Intronic
1184429374 22:44432321-44432343 TCTTCACACCTGGCCGGGCGTGG + Intergenic
1184481158 22:44748222-44748244 TGACCCAAGCTGGCCGGGCGTGG - Intronic
1184611610 22:45607486-45607508 TGCAGAGAGCTGGCCGGGCGTGG + Intergenic
1184731600 22:46373776-46373798 TGTCCAGAGCAGGCCGGTTGGGG - Intronic
1184845881 22:47086172-47086194 TAGCCATGGCTGGCCGAGCGCGG + Intronic
1185145353 22:49131911-49131933 TATTCTGACCTGGCTGGGCGAGG - Intergenic
1185244202 22:49764598-49764620 TAAGCAGAGATGGCCGGGCGCGG + Intergenic
1185257290 22:49841894-49841916 TACACCTAGCTGGCCGGGCGCGG - Intergenic
949347584 3:3090861-3090883 TACCCTGTGTTGGCCGGGCGTGG - Intronic
949546201 3:5074916-5074938 TTTTTAGTGCTGGCCGGGCGTGG + Intergenic
949778698 3:7661502-7661524 TATAAAATGCTGGCCGGGCGCGG + Intronic
949929793 3:9069656-9069678 TAGCAAGAGCGGGCTGGGCGCGG + Intronic
951173299 3:19568503-19568525 TCTCCAGTACTAGCCGGGCGTGG + Intergenic
951329543 3:21349666-21349688 GATGTAAAGCTGGCCGGGCGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951893865 3:27592307-27592329 AATCCACACCTGGCTGGGCGTGG + Intergenic
951971812 3:28454132-28454154 TATACACAATTGGCCGGGCGCGG - Intronic
952369565 3:32708186-32708208 TAATAATAGCTGGCCGGGCGTGG - Intronic
952468506 3:33618236-33618258 TATCCTCACCAGGCCGGGCGCGG - Intronic
952481887 3:33770112-33770134 TAGCCAGATGTGGCCGGGCATGG - Intergenic
952498273 3:33935184-33935206 TGTCCAGAATAGGCCGGGCGCGG - Intergenic
952775982 3:37047155-37047177 TAACCAAAGCTGGGCGGGTGAGG - Intronic
953240005 3:41140496-41140518 TATCCAGAGGTCCCCGGGAGAGG + Intergenic
953349072 3:42201166-42201188 AATACAGACCTGGCCGGGCGTGG + Intronic
953795119 3:45979148-45979170 ACTCCAGAACAGGCCGGGCGCGG - Intronic
953870947 3:46627325-46627347 TATTCAGAGCTGGCAGGTCCTGG + Intergenic
954170333 3:48796778-48796800 TAAAAAGAGTTGGCCGGGCGCGG - Intronic
954405024 3:50340843-50340865 TAGCAAGCGCGGGCCGGGCGGGG + Intronic
954654736 3:52187058-52187080 GATTCTGACCTGGCCGGGCGCGG + Intergenic
954727940 3:52631682-52631704 TATCAAAAGTTGGCCAGGCGAGG - Intronic
955187198 3:56725902-56725924 TGGTGAGAGCTGGCCGGGCGTGG + Intergenic
955228472 3:57079412-57079434 TGTCGAGCGGTGGCCGGGCGTGG - Intergenic
955357211 3:58241018-58241040 TATCCAGGTTTGGCCGGGCGCGG - Intronic
955400114 3:58585514-58585536 GTTCCAGAGCGGGCCGCGCGGGG + Intronic
956510621 3:69989261-69989283 TTACCAGAGGGGGCCGGGCGCGG - Intergenic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
957382166 3:79445940-79445962 TTGCCAGGCCTGGCCGGGCGCGG - Intronic
957641496 3:82859825-82859847 AATACACAGGTGGCCGGGCGCGG + Intergenic
959122869 3:102253646-102253668 AAAACATAGCTGGCCGGGCGCGG - Intronic
959691831 3:109206108-109206130 TATGCAAGGTTGGCCGGGCGTGG + Intergenic
959737188 3:109672956-109672978 TATCCAGAGATGGCTGGGTGGGG + Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960076700 3:113494355-113494377 TATTCACAATTGGCCGGGCGCGG + Intronic
960139383 3:114137699-114137721 TAGCCAGATGTGGCCGGGCGCGG + Intronic
960803473 3:121561336-121561358 TGCCCAGGGTTGGCCGGGCGTGG + Intergenic
961739418 3:129023620-129023642 AATCAAGAGGTGGCCAGGCGCGG - Intronic
961756730 3:129132117-129132139 GATACAGAACTGGCCGGGGGTGG - Intronic
961845672 3:129761033-129761055 TCCCCTGTGCTGGCCGGGCGCGG + Intronic
962512899 3:136120119-136120141 TATCCAGGCCTGTCCGGGGGGGG + Intronic
962771277 3:138612389-138612411 TAGCCAGACAAGGCCGGGCGCGG - Intronic
962801892 3:138897671-138897693 CAGCCAGAGCTGGCTGGGTGCGG + Intergenic
964093589 3:152904882-152904904 TACATAGACCTGGCCGGGCGCGG + Intergenic
964134215 3:153326163-153326185 AATCAAAAGTTGGCCGGGCGTGG - Intergenic
964230516 3:154461574-154461596 TATACAGAATTAGCCGGGCGTGG - Intergenic
964379981 3:156088226-156088248 TATCAAGATATGGCCGGGCATGG - Intronic
964539592 3:157764841-157764863 TATCCAATACTGGCCAGGCGCGG + Intergenic
965020722 3:163226768-163226790 AATTAAGACCTGGCCGGGCGCGG - Intergenic
966697747 3:182809537-182809559 TGTACAGAGCGGGCAGGGCGTGG - Intronic
966844217 3:184114473-184114495 TATTCAGGGCAGGCCGGGTGCGG + Intergenic
967292783 3:187937420-187937442 TATACAAACTTGGCCGGGCGTGG + Intergenic
967333201 3:188313347-188313369 TATCTAGTTCTGGCTGGGCGTGG + Intronic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967727116 3:192872284-192872306 GTTGCAAAGCTGGCCGGGCGCGG + Intronic
968024139 3:195424587-195424609 TAGTCAAAACTGGCCGGGCGCGG - Intronic
968111033 3:196046950-196046972 TATACAAAGCTGGCCAGGTGCGG + Intronic
968376759 4:50290-50312 TATAAATAGCCGGCCGGGCGCGG + Intergenic
968467036 4:757876-757898 AATCCAAAGTTGGCCCGGCGCGG + Intronic
968813884 4:2812001-2812023 TATTCAGAGGTGGCCCTGCGGGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969364187 4:6684606-6684628 TTTCCTGAGCTGGCAGGGCTGGG + Intergenic
969514316 4:7638110-7638132 TAGGCTGAGCTGGCCGGGCTGGG + Intronic
969580658 4:8062727-8062749 TACTCAGACCAGGCCGGGCGTGG - Intronic
969595311 4:8145472-8145494 AATCAATACCTGGCCGGGCGCGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
970239628 4:13994908-13994930 AATAAATAGCTGGCCGGGCGCGG - Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
970416591 4:15863965-15863987 ACTTCAGAGCCGGCCGGGCGCGG + Intergenic
970616239 4:17770754-17770776 AATCTAGTTCTGGCCGGGCGCGG - Intronic
970859137 4:20682095-20682117 TAACCAGAGCCAGCCGAGCGCGG + Intergenic
970960621 4:21867059-21867081 CAGGCTGAGCTGGCCGGGCGTGG - Intronic
971492875 4:27232641-27232663 TATCCAGAATGGGCCGGGCGTGG - Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
971816469 4:31496938-31496960 GATCCAGTGTGGGCCGGGCGCGG + Intergenic
972630273 4:40836184-40836206 AAGACAAAGCTGGCCGGGCGCGG + Intronic
973674144 4:53247567-53247589 TAACAAGATCAGGCCGGGCGCGG + Intronic
973823468 4:54683344-54683366 TATGCAGTTATGGCCGGGCGCGG + Intronic
975099523 4:70496759-70496781 TAGCCAAACTTGGCCGGGCGCGG - Intergenic
975145283 4:70960170-70960192 TAAGCACAACTGGCCGGGCGTGG - Intronic
975602043 4:76111696-76111718 TATACAGAATTAGCCGGGCGTGG - Intronic
976271740 4:83237480-83237502 TATTTAGACCTGGCCGGGCACGG - Intergenic
977241698 4:94578118-94578140 TAAGAAGAGTTGGCCGGGCGCGG - Intronic
977310124 4:95375785-95375807 TATACAGAATAGGCCGGGCGTGG + Intronic
977455972 4:97260116-97260138 TATACCCTGCTGGCCGGGCGCGG + Intronic
977576072 4:98675436-98675458 TATCCACAACTGGCTGGGTGTGG + Intergenic
977941857 4:102868356-102868378 AATCCAAAGCTGGCCGGGCGCGG - Intronic
978089912 4:104702663-104702685 TATGAAGCACTGGCCGGGCGCGG - Intergenic
978101635 4:104848550-104848572 TATCAAGGTCAGGCCGGGCGTGG - Intergenic
978411176 4:108427661-108427683 TATCTACATCTGGCCGGGCATGG - Intergenic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979643990 4:123045803-123045825 TATCCTGTTTTGGCCGGGCGAGG + Intronic
980810858 4:137877301-137877323 TATACAAAGCTGGCCAGGCACGG - Intergenic
981314850 4:143332028-143332050 TATCCAAATCAGGCCGGGCGAGG - Intergenic
981370757 4:143956279-143956301 TAGTAAGAACTGGCCGGGCGCGG + Intergenic
982007036 4:151073395-151073417 TATAAAGACCTGGCCAGGCGTGG + Intergenic
982581625 4:157186394-157186416 TACATAAAGCTGGCCGGGCGCGG - Intergenic
982737636 4:159022739-159022761 TATCGTGTGTTGGCCGGGCGCGG + Intronic
983479631 4:168257032-168257054 TATACACAGTTGGCCGGGCATGG + Intronic
983943548 4:173561959-173561981 AATCCAGATTAGGCCGGGCGTGG + Intergenic
984083737 4:175282721-175282743 TAGCTAGAGTCGGCCGGGCGTGG + Intergenic
984450520 4:179895190-179895212 AATCAAGAGTTGGCCGGGCATGG - Intergenic
985026801 4:185746606-185746628 TAACCAGATAAGGCCGGGCGCGG - Intronic
985156279 4:186990939-186990961 TAGCCACAGATGGCTGGGCGAGG + Intergenic
985210598 4:187588624-187588646 GATCAAGAGATGGCTGGGCGTGG - Intergenic
985221055 4:187705959-187705981 TATACATAACAGGCCGGGCGCGG + Intergenic
985310217 4:188589468-188589490 AGTACAGATCTGGCCGGGCGCGG + Intergenic
985616923 5:928294-928316 TATCCAGTCTTGGCCGGGCGTGG + Intergenic
986488847 5:8269094-8269116 TCTCGAAAGCTGGCCGGGGGAGG - Intergenic
986550894 5:8953732-8953754 TATCAAAAGCTGGCCGGGCGTGG - Intergenic
986600652 5:9469295-9469317 AATCCATTGCTGGCCGGGTGTGG - Intronic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987065883 5:14289095-14289117 TAGCCAGGTGTGGCCGGGCGCGG + Intronic
987554902 5:19434078-19434100 AATCCAGCATTGGCCGGGCGCGG - Intergenic
988037028 5:25840492-25840514 TATCTGCAGCTGGCCGAGCGTGG + Intergenic
988280595 5:29141010-29141032 TAACGAGGTCTGGCCGGGCGTGG - Intergenic
988355534 5:30169163-30169185 TATTCAGATATGGCCGGGAGTGG + Intergenic
990331492 5:54730487-54730509 TACCCTGAGATGGCCAGGCGCGG + Intergenic
990439863 5:55833651-55833673 GAACCAGACCTGGCCGGGCACGG + Intergenic
990450545 5:55928590-55928612 ACTCCAGAGCTGGCCAGGCTGGG - Intergenic
990505939 5:56445365-56445387 TATCTATATCTGGTCGGGCGCGG + Intergenic
990546314 5:56825301-56825323 AATCTAGACCTGGCCGGGCATGG - Intronic
990685964 5:58301221-58301243 TACACAGATCTGGCCGGGCATGG - Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991649511 5:68837542-68837564 TACCCATTTCTGGCCGGGCGCGG - Intergenic
991697458 5:69286521-69286543 TATCTAAAGTTGGCCGGGCGCGG - Intronic
992419537 5:76589021-76589043 TACCAATACCTGGCCGGGCGTGG + Intronic
992422416 5:76619806-76619828 GATCCTTAACTGGCCGGGCGCGG - Intronic
993299424 5:86189152-86189174 TTTACACAGGTGGCCGGGCGCGG + Intergenic
993668448 5:90730145-90730167 TACCCAGAGTCGGCTGGGCGTGG - Intronic
993782238 5:92081507-92081529 TATCAAGTGCAGGCTGGGCGCGG - Intergenic
995049298 5:107684208-107684230 AGTCCAGAACAGGCCGGGCGTGG + Intergenic
995135515 5:108675772-108675794 AATGGAGACCTGGCCGGGCGCGG - Intergenic
995757737 5:115527710-115527732 TAGCAAAAGCTGGCCAGGCGCGG + Intronic
996359335 5:122628089-122628111 ATTCTAGAGCTGGCCGGGCGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
996997355 5:129714127-129714149 AATACATATCTGGCCGGGCGCGG + Intronic
997113899 5:131104961-131104983 GATACAGAGTTGGCCGGGTGTGG + Intergenic
997597509 5:135116918-135116940 TAAACAGAGCCGGCCAGGCGCGG - Intronic
997791640 5:136767454-136767476 TAGAAAGTGCTGGCCGGGCGCGG + Intergenic
998216459 5:140241543-140241565 TTTCCAGAGCTGGCAGGGGAGGG + Intronic
998371981 5:141667716-141667738 AATACAGTACTGGCCGGGCGTGG - Intronic
999265997 5:150267201-150267223 CATCCAGAGCTGACCAGGCGGGG + Intronic
1000802600 5:165747574-165747596 TAACCTGACCTGGCCGGGCGCGG + Intergenic
1001030330 5:168257902-168257924 AATCAGGAGCTGGCCGGGCACGG - Intronic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1001811273 5:174630097-174630119 CATCCAGTGTTGGTCGGGCGCGG + Intergenic
1002305390 5:178279848-178279870 TACCCAGACCTGGCCTGGTGGGG - Intronic
1002341773 5:178521261-178521283 TATTTAAAGCTGGCCGGGCGCGG + Intronic
1002418547 5:179133558-179133580 TATCAAAACTTGGCCGGGCGCGG - Intronic
1002719620 5:181250243-181250265 AATGCAGGGATGGCCGGGCGCGG + Intergenic
1002918886 6:1551767-1551789 GATGTAGAGATGGCCGGGCGTGG + Intergenic
1002995730 6:2282798-2282820 TAGCCAGGCATGGCCGGGCGTGG + Intergenic
1003086913 6:3068032-3068054 TATGCACATCAGGCCGGGCGCGG - Intronic
1003139472 6:3457949-3457971 TATACAGCGCTGGCTGGGCAAGG - Intergenic
1003636705 6:7838650-7838672 TGTCCTTAGCTGGCTGGGCGCGG + Intronic
1003848636 6:10199508-10199530 GAAACAGAACTGGCCGGGCGCGG - Intronic
1004099152 6:12591297-12591319 TAGCCAGGCGTGGCCGGGCGCGG + Intergenic
1004521432 6:16364591-16364613 TATCTAGAACTGGCTGGGTGCGG - Intronic
1004715662 6:18214213-18214235 TACCCAGAGCTGGACGGGGGTGG + Intronic
1004722303 6:18277797-18277819 TTTCCAGAGCTTCCCGGGGGCGG - Intergenic
1004933679 6:20486560-20486582 TATGCATATGTGGCCGGGCGCGG - Intronic
1004935265 6:20501247-20501269 TTAACAGACCTGGCCGGGCGTGG + Intergenic
1005616933 6:27582521-27582543 TATACAGGACAGGCCGGGCGCGG - Intergenic
1006631576 6:35433997-35434019 TATGAAAAGATGGCCGGGCGTGG + Intergenic
1006842639 6:37039654-37039676 GATGCTGAGCAGGCCGGGCGTGG + Intergenic
1006842799 6:37040848-37040870 TAGCCAGTCATGGCCGGGCGTGG - Intergenic
1007242506 6:40437236-40437258 AATGCAGAGCTGGCGGGGAGAGG - Intronic
1007568963 6:42875405-42875427 TACCTATAACTGGCCGGGCGCGG + Intergenic
1007736370 6:43984818-43984840 TGTCCAGCCCTGGCGGGGCGGGG - Intergenic
1009558942 6:65213868-65213890 TACTGAAAGCTGGCCGGGCGTGG + Intronic
1010648115 6:78418202-78418224 GATACAAAGCAGGCCGGGCGTGG - Intergenic
1010651677 6:78462986-78463008 TCTCCAAAGCAGGCTGGGCGTGG + Intergenic
1010753893 6:79644867-79644889 GGTCCTGAGTTGGCCGGGCGCGG + Intronic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011514560 6:88138816-88138838 ATTTAAGAGCTGGCCGGGCGCGG + Intergenic
1011686560 6:89828702-89828724 TAGCCAGGGGTGGCCGGGCGTGG + Intergenic
1011717388 6:90121834-90121856 TATGCAAAGGTGGCCGGGCACGG - Intronic
1012197932 6:96367746-96367768 ATTGTAGAGCTGGCCGGGCGCGG - Intergenic
1012577233 6:100818276-100818298 AATCCACAGCTGGCCAGGCACGG + Intronic
1012885918 6:104845765-104845787 TACCCAGAGTTGGCTGGGTGTGG - Intronic
1013520753 6:110931112-110931134 TATCAGGGGCTGGCCGGGCGTGG + Intergenic
1014006919 6:116429656-116429678 TATGAGGAGTTGGCCGGGCGCGG + Intronic
1015288276 6:131509224-131509246 TATGCAGAGCTGGCTGGGATTGG + Intergenic
1015520637 6:134127758-134127780 AATTCACAGCTGGCCAGGCGTGG + Intergenic
1015717884 6:136210867-136210889 TAGCCTGAGTTGGCCGGGCGTGG + Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016837966 6:148498091-148498113 TATCAAAGGCTGGCTGGGCGTGG + Intronic
1016851753 6:148626620-148626642 TCTTCACAGCAGGCCGGGCGCGG + Intergenic
1017778475 6:157698052-157698074 TATTCTGAGCCGGCCGGGCGCGG + Intergenic
1017783571 6:157735398-157735420 AGCCCAGACCTGGCCGGGCGTGG + Intronic
1018005515 6:159618740-159618762 TAAGCAGAGTTGGCCAGGCGTGG + Intergenic
1018591095 6:165423575-165423597 TACCCAGATTAGGCCGGGCGCGG + Intronic
1019179591 6:170177949-170177971 GACCCTGAGCTGGCCGGGTGGGG + Intergenic
1019584323 7:1789174-1789196 TACACTAAGCTGGCCGGGCGTGG + Intergenic
1019700980 7:2474978-2475000 TATGCAGGGCTGGCAGGGAGAGG + Intronic
1019745298 7:2696592-2696614 CTTCCAGGGCTGGCCGGGCACGG + Intronic
1019782482 7:2951789-2951811 AAACCAGACCTGGCTGGGCGTGG - Intronic
1020034349 7:4955760-4955782 AATTTAAAGCTGGCCGGGCGTGG + Intronic
1020224370 7:6268458-6268480 TTACAAGAGCAGGCCGGGCGCGG - Intronic
1021387911 7:20054712-20054734 TCTACAGAACAGGCCGGGCGCGG + Intergenic
1021730563 7:23591506-23591528 GAAAAAGAGCTGGCCGGGCGCGG - Intergenic
1022547689 7:31203887-31203909 CATCCAGAGGTGGCAGGGCTTGG + Intergenic
1022587903 7:31633173-31633195 TCCCCAGACCTGGCCGGTCGCGG - Intronic
1022840693 7:34161199-34161221 GAAACATAGCTGGCCGGGCGTGG + Intergenic
1022871712 7:34487024-34487046 AATCCAGTTCTGGCCGGGCGCGG + Intergenic
1023801550 7:43839304-43839326 AATACAAAGCTGGCCGGGCGCGG + Intergenic
1024994099 7:55258091-55258113 TATAGAAAGCCGGCCGGGCGCGG - Intergenic
1025801697 7:64792866-64792888 TAGCCAGTCATGGCCGGGCGCGG - Intergenic
1025939206 7:66061774-66061796 AAACCAGATCTGGCCGGGTGCGG + Intergenic
1026021147 7:66707073-66707095 TAACCAGTACGGGCCGGGCGCGG - Intronic
1026945764 7:74314984-74315006 GACACAAAGCTGGCCGGGCGTGG + Intronic
1027191593 7:75999834-75999856 TATACATAACAGGCCGGGCGCGG - Intronic
1027196911 7:76037072-76037094 TAAGAAGAGCTGGCCGGGTGCGG - Intronic
1028505514 7:91566120-91566142 TTTCCAGAGCTGTCAGGGCTTGG - Intergenic
1029427785 7:100507560-100507582 AATCCACAGGTGGCTGGGCGTGG - Intergenic
1029589155 7:101495707-101495729 TACCCTACGCTGGCCGGGCGCGG - Intronic
1030028518 7:105348225-105348247 AATACAGAATTGGCCGGGCGTGG - Intronic
1032196391 7:129791467-129791489 AATCCAGATATGGCCGGGTGTGG + Intergenic
1032206839 7:129873307-129873329 TACTCTGAGCTGGCTGGGCGTGG - Intronic
1032224402 7:130019337-130019359 AAACCAGTGCAGGCCGGGCGTGG - Intronic
1032373352 7:131383011-131383033 TATCCGTAGCTGGCCGGGTGTGG - Intronic
1032836952 7:135683480-135683502 TATCCAGGGCTGAGCGGGGGGGG - Intronic
1033481243 7:141743141-141743163 AATCCACACCTGGCTGGGCGCGG - Intronic
1033487407 7:141804656-141804678 TAACAAGAGGTGGCCGGGCCTGG + Intergenic
1033720776 7:144057102-144057124 TAAGAAGAGTTGGCCGGGCGCGG - Intergenic
1033814891 7:145059756-145059778 TGTCAAGATGTGGCCGGGCGCGG + Intergenic
1034179456 7:149126304-149126326 AAGGCAGAGCCGGCCGGGCGCGG + Exonic
1034183394 7:149156014-149156036 TATATAAAACTGGCCGGGCGCGG - Intronic
1034618562 7:152439324-152439346 TAACCAGGCCTGGCTGGGCGCGG + Intergenic
1035190448 7:157163093-157163115 TACCCAGAGATGGCCGGGCGCGG + Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036517153 8:9455011-9455033 TATGCAGCCCTGGCTGGGCGCGG + Intergenic
1036714324 8:11106556-11106578 GATACAATGCTGGCCGGGCGCGG + Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037724796 8:21474244-21474266 TCTCCAGAGCTGGACGTGCCTGG - Intergenic
1037964732 8:23125268-23125290 AAACAAGAGCCGGCCGGGCGCGG - Intergenic
1038605015 8:28992578-28992600 TATACAATGCTGGCTGGGCGCGG + Intronic
1038963505 8:32548092-32548114 CCTCCCGCGCTGGCCGGGCGGGG - Intronic
1039482078 8:37881643-37881665 AATCCAGAGCTGGGCAGGCGGGG + Intronic
1039698996 8:39943445-39943467 AACCTATAGCTGGCCGGGCGCGG + Intronic
1040463741 8:47675324-47675346 AAAACATAGCTGGCCGGGCGTGG - Intronic
1041269802 8:56100602-56100624 TGGTCAGAGGTGGCCGGGCGCGG + Intergenic
1041609764 8:59831343-59831365 TAATCAGAGATGGCCGGGCGTGG - Intergenic
1043043588 8:75293392-75293414 AATACAGAAGTGGCCGGGCGCGG + Intergenic
1044447782 8:92298625-92298647 TATTGAGAGTTGGCTGGGCGTGG - Intergenic
1044859265 8:96506719-96506741 TAGCCTTAGCTGGCCGGGCACGG + Intronic
1044975944 8:97665834-97665856 TGTAAAGATCTGGCCGGGCGCGG + Intronic
1045094991 8:98788149-98788171 GATACAGAACTGGCCGGGCATGG + Intronic
1045302326 8:100922672-100922694 AAACCAGGGTTGGCCGGGCGTGG - Intronic
1045526529 8:102945223-102945245 TATTCATTGTTGGCCGGGCGCGG - Intronic
1045857096 8:106776943-106776965 AATCCACAGCTGGCCGGGCGCGG - Intergenic
1047645758 8:126868021-126868043 AACCCAGTTCTGGCCGGGCGTGG - Intergenic
1049431236 8:142566248-142566270 GAGCCAGAGCTGGCCGGGCAGGG - Intergenic
1049893371 9:91840-91862 TATACAAAGCTGGCAGGGCCGGG + Intergenic
1050452419 9:5797357-5797379 TAACCAGCTTTGGCCGGGCGTGG + Intronic
1050560314 9:6828435-6828457 ATTCCAGAGATGGCCGGGCACGG - Intronic
1051277915 9:15414945-15414967 AATCTAGACCAGGCCGGGCGCGG + Intergenic
1051690434 9:19706666-19706688 AATCAAGACCCGGCCGGGCGCGG - Intronic
1051894512 9:21974180-21974202 TATTCAGAAGCGGCCGGGCGCGG - Intronic
1052526411 9:29625003-29625025 TACCCAGGCTTGGCCGGGCGCGG - Intergenic
1052838961 9:33274904-33274926 TAGCCATATCTGGCCAGGCGCGG - Intronic
1052959755 9:34285482-34285504 TAGCCAGGTCTGGCAGGGCGTGG + Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053640032 9:40064247-40064269 AATCCAAATTTGGCCGGGCGCGG - Intergenic
1053688371 9:40566083-40566105 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1053734590 9:41091922-41091944 TATACAAAGCTGGCAGGGCCGGG + Intergenic
1053766100 9:41401235-41401257 AATCCAAATTTGGCCGGGCGCGG + Intergenic
1053939735 9:43221559-43221581 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1054275659 9:63064967-63064989 AATCCAGAGTGGGCCGGGCATGG + Intergenic
1054299612 9:63366994-63367016 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1054399174 9:64699962-64699984 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1054432752 9:65184228-65184250 AATCCAGAGTGGGCCGGGCATGG - Intergenic
1054497633 9:65837448-65837470 AATCCAGAGTGGGCCGGGCATGG + Intergenic
1054544715 9:66312388-66312410 AATCCAAATTTGGCCGGGCGCGG + Intergenic
1054693790 9:68339492-68339514 TATACAAAGCTGGCAGGGCCGGG - Intronic
1055053785 9:72005050-72005072 TATCCAGCACAGGCCGAGCGTGG + Intergenic
1055196388 9:73599564-73599586 AAACCATTGCTGGCCGGGCGCGG - Intergenic
1055817177 9:80220431-80220453 TAAACAGAGTTGGCCGGGCGCGG + Intergenic
1055961177 9:81821871-81821893 TATAAAGAGATGGCCGGGCGCGG + Intergenic
1056116613 9:83447311-83447333 AACCCTGATCTGGCCGGGCGCGG - Intronic
1056339318 9:85609569-85609591 AACCAAGATCTGGCCGGGCGCGG - Intronic
1056984092 9:91345541-91345563 TACCCAGAGAAGGCCAGGCGTGG + Intronic
1057809171 9:98244366-98244388 TATGCAGACCTGGCTGGGAGCGG + Intronic
1058563185 9:106251132-106251154 AATCCAAGACTGGCCGGGCGCGG - Intergenic
1058621527 9:106888329-106888351 AATCCACATTTGGCCGGGCGCGG - Intronic
1058926426 9:109668224-109668246 AAACCAAAGCCGGCCGGGCGCGG - Intronic
1058963017 9:110009422-110009444 GATGCAAAGTTGGCCGGGCGCGG + Intronic
1059187381 9:112287035-112287057 TAGCCAGAGCTGGGCAGGGGTGG - Intronic
1059209842 9:112503361-112503383 TTTCAAGAGCTGGCTGGTCGCGG + Intronic
1060543221 9:124445711-124445733 TATCCAGCACTGGCTGGGTGTGG - Intergenic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060920984 9:127420172-127420194 TAGCCAGGTCTGGCCTGGCGTGG + Intergenic
1061072358 9:128319034-128319056 TAGCCAGGCATGGCCGGGCGTGG + Intronic
1061216190 9:129223403-129223425 GAAGCAGAGCGGGCCGGGCGTGG - Intergenic
1061331810 9:129899366-129899388 CTTCCAGATCTGGCCGGGCATGG - Intronic
1061350592 9:130061651-130061673 TAGCCAGGGCAGGCCGGGCGTGG + Intronic
1062255243 9:135617742-135617764 CAATCAGAGCTGGCCGGGCCTGG + Intergenic
1062259936 9:135656496-135656518 TATTAAAAGCTGGCCAGGCGCGG + Intergenic
1062329630 9:136032604-136032626 TATCCAGAACAGGCCAGGCCTGG + Intronic
1062332070 9:136049245-136049267 TCTCTAGACCTGGCCGGGTGAGG + Intronic
1062551293 9:137087855-137087877 TAAATAGAGCTGGCCGGGCACGG + Intronic
1203572471 Un_KI270744v1:143956-143978 TATAAATAGCCGGCCGGGCGCGG - Intergenic
1185576650 X:1179958-1179980 TATCCAGGTGTGGCCGGGCACGG - Intergenic
1185655474 X:1680872-1680894 AAATCATAGCTGGCCGGGCGCGG + Intergenic
1185729356 X:2448896-2448918 TATCCACACTGGGCCGGGCGCGG + Intronic
1186448469 X:9652564-9652586 TGTTTAGTGCTGGCCGGGCGTGG + Intronic
1186737211 X:12478282-12478304 AAACCAGAGTAGGCCGGGCGTGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186825433 X:13335059-13335081 TATGAAGATCTGGCCGGGCGTGG - Intergenic
1187266620 X:17739556-17739578 TATCAAGAATTGGCCAGGCGCGG + Intronic
1187421647 X:19139542-19139564 TATAAAGGGCTGGCCGGGCGTGG - Intergenic
1187502231 X:19849098-19849120 TGTCCACAGCTGGCCAGGCACGG - Intronic
1187913474 X:24131926-24131948 ACTCCTGAGCTGGCCGGGGGAGG - Intergenic
1187949703 X:24459877-24459899 TACCCTCAGGTGGCCGGGCGCGG + Intergenic
1187953402 X:24492709-24492731 TGACCAGAGCTGGCTGGGCGCGG + Intronic
1187981573 X:24763026-24763048 TATTAACATCTGGCCGGGCGTGG - Intronic
1188282047 X:28282268-28282290 CATACAGTTCTGGCCGGGCGCGG + Intergenic
1188512050 X:30946935-30946957 AATTCAGATGTGGCCGGGCGTGG + Intronic
1188581104 X:31715252-31715274 GATTAAGAGCTGGCCGGGCGCGG + Intronic
1188885376 X:35543348-35543370 TATCTTGAGATGGCCAGGCGTGG - Intergenic
1188926924 X:36055072-36055094 TACTAAGAGCTGGCCGGGCATGG - Intronic
1189461948 X:41250209-41250231 TATGCAAAATTGGCCGGGCGTGG + Intergenic
1189919176 X:45886719-45886741 TAAGCAGAGTGGGCCGGGCGTGG + Intergenic
1190092725 X:47453779-47453801 AATATGGAGCTGGCCGGGCGCGG + Intronic
1190242863 X:48671368-48671390 TATCCAGGTGTGGCTGGGCGTGG - Intergenic
1190868926 X:54408761-54408783 AAACCAGACCTGGCTGGGCGTGG + Intergenic
1192366137 X:70475038-70475060 TATACAGTGCAGGCCGGGCATGG + Intronic
1192467712 X:71369138-71369160 TGGCCAGATGTGGCCGGGCGTGG - Intronic
1192734088 X:73832042-73832064 TAACAACAGCTGGCCAGGCGTGG + Intergenic
1193216878 X:78874820-78874842 TACAAAAAGCTGGCCGGGCGTGG + Intergenic
1194011924 X:88572528-88572550 TAACTACAACTGGCCGGGCGCGG + Intergenic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194362914 X:92976726-92976748 TATGGGTAGCTGGCCGGGCGCGG - Intergenic
1195060778 X:101191716-101191738 TATCCTGGGCCGGCCGGGCGGGG - Intergenic
1195297216 X:103490669-103490691 TAGTCAGGGGTGGCCGGGCGCGG - Intergenic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195789700 X:108569968-108569990 TAGAAAGATCTGGCCGGGCGCGG - Intronic
1196216686 X:113061050-113061072 TATGCGAATCTGGCCGGGCGCGG + Intergenic
1196308886 X:114137666-114137688 TATAGAGTGCTGGCCGGGCGCGG + Intergenic
1196835355 X:119808650-119808672 TATCCAGAGCTGGACAGGCAAGG + Intergenic
1196836238 X:119816548-119816570 TATCCAGAGCTGGACAGGCCAGG + Intergenic
1196837214 X:119824428-119824450 TATCCAGAGCTGGACAGGCAAGG + Intergenic
1197203752 X:123772157-123772179 TACCCTGCCCTGGCCGGGCGCGG + Intergenic
1197594533 X:128450201-128450223 TTCCCAGAGACGGCCGGGCGCGG - Intergenic
1197686231 X:129442436-129442458 TACCCAATACTGGCCGGGCGTGG + Intergenic
1197701784 X:129605229-129605251 TTCCCAGTGCTGGCTGGGCGCGG + Intergenic
1197942985 X:131808911-131808933 TATCTAGCCATGGCCGGGCGCGG - Intergenic
1200671157 Y:6092955-6092977 TATGGGTAGCTGGCCGGGCGCGG - Intergenic