ID: 918374231

View in Genome Browser
Species Human (GRCh38)
Location 1:183892709-183892731
Sequence ACCTGCTTCTAGAAATATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374229_918374231 17 Left 918374229 1:183892669-183892691 CCAGACATTTGTTGAATGCCTAA 0: 1
1: 0
2: 1
3: 29
4: 279
Right 918374231 1:183892709-183892731 ACCTGCTTCTAGAAATATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156
918374230_918374231 -1 Left 918374230 1:183892687-183892709 CCTAATATTTGTAAAGCTTTGAA 0: 1
1: 0
2: 5
3: 58
4: 531
Right 918374231 1:183892709-183892731 ACCTGCTTCTAGAAATATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918374231 Original CRISPR ACCTGCTTCTAGAAATATGA AGG Intronic
901542823 1:9931861-9931883 ACCAGCTTTCAGAAATATGAGGG + Intronic
901743125 1:11355475-11355497 ACCTGCCTCGAGAAATCTGCCGG - Intergenic
906541577 1:46590854-46590876 CCTAGCTTCTGGAAATATGAAGG + Intronic
906764404 1:48414267-48414289 CCCTGCTGGTGGAAATATGAGGG - Intronic
907376449 1:54047095-54047117 AGCTGCTGCTAGAAATTTCATGG - Intronic
907557688 1:55359050-55359072 CCCTGCTTTGGGAAATATGACGG + Intergenic
909358417 1:74734068-74734090 AGCTGCTTCTTGATTTATGATGG - Intronic
909989233 1:82201790-82201812 TCCTAATTCTAGAAATATAAAGG - Intergenic
910692835 1:89982253-89982275 ACTTGCTTCTAGAAATACCTGGG + Intergenic
911412951 1:97533748-97533770 TTCTCCTTCTAGAAATATAAGGG - Intronic
915772600 1:158444127-158444149 ATTTGCTTCTGGAAAAATGAGGG - Intergenic
917646161 1:177030747-177030769 CCCTGCCTCTACCAATATGAAGG + Intronic
918374231 1:183892709-183892731 ACCTGCTTCTAGAAATATGAAGG + Intronic
919530094 1:198706277-198706299 ACCTGTTTCTTGATATATGTGGG - Intronic
920810655 1:209282494-209282516 TCCTGCTTATAGAAATTTGGAGG - Intergenic
922628124 1:227073755-227073777 GCTTGCTTTTAGAAAAATGATGG - Intronic
923278523 1:232419218-232419240 TCCTGCTTATGGAAAAATGATGG - Intronic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
924902862 1:248420028-248420050 ACATCCATCTAAAAATATGATGG - Intergenic
1066246282 10:33586187-33586209 ATCTGCATTTGGAAATATGAGGG - Intergenic
1071879741 10:89883638-89883660 AACTGCTTCTAGCAATAAGCTGG + Intergenic
1072601590 10:96935960-96935982 ACCTGTTGCTACGAATATGATGG - Intronic
1074466917 10:113691709-113691731 ACCTACTGCTGGAAATTTGAGGG - Intronic
1078351062 11:10593893-10593915 AGCTGCCTGTAGCAATATGAAGG + Intronic
1079597241 11:22265332-22265354 ACCTGGTTCTAGAAATGAAAGGG - Intronic
1080516637 11:33028524-33028546 ACCTGCTTAGAAAAATATTATGG + Intronic
1080694674 11:34592339-34592361 AGCTGCTTCTCAAATTATGATGG - Intergenic
1087571690 11:99935479-99935501 ATCTGATACTAGAAATTTGAGGG + Intronic
1089218707 11:116852731-116852753 CCCTGCTTGCAGAATTATGAGGG + Intronic
1089874106 11:121703579-121703601 ACCTCCTACCAGAAATAGGAAGG - Intergenic
1090605378 11:128417800-128417822 ACGTGCTTCCAGAAATAGAAAGG + Intergenic
1095032643 12:37313112-37313134 ATCTGCTTGTGGATATATGAAGG + Intergenic
1095812706 12:46387439-46387461 ACTTGCTTAAAAAAATATGATGG - Intergenic
1096437219 12:51603525-51603547 ATCAGCTTTGAGAAATATGAAGG - Intronic
1097461240 12:59864978-59865000 ACCAGCTACCAGAAATATGTGGG + Intergenic
1097707812 12:62885898-62885920 ACCTGCTTATAGTAACATCAGGG + Intronic
1098048259 12:66425169-66425191 TCCTTCTTTTAGAAATTTGAAGG + Intronic
1098943461 12:76563690-76563712 TTCTGTTTCTAGAAATATCAAGG + Intergenic
1099532060 12:83795158-83795180 ACCTTCTTCTGGAAAGATGAAGG + Intergenic
1102331850 12:112039717-112039739 ACCTGCTTGGAGAGATGTGACGG - Intronic
1104222114 12:126795132-126795154 ACCTGATTCTAAATAAATGAAGG - Intergenic
1104428764 12:128699387-128699409 ATCTGCTTCTAGAATTATTTGGG + Intronic
1106976985 13:35230615-35230637 ACATGATTCTAGAGATTTGAAGG + Intronic
1108089005 13:46826015-46826037 ACATACTTCTACAAATATAAAGG + Intergenic
1108451524 13:50571201-50571223 ACGTGTTTCTACCAATATGATGG + Intronic
1108700715 13:52941671-52941693 ACCTCCTTCTGGAAAGCTGAGGG - Intergenic
1108742477 13:53352482-53352504 ACCTGCTTCTAGAGCTCTTATGG + Intergenic
1111233122 13:85371228-85371250 CTCTACTTCTAGAAATATGATGG + Intergenic
1113789402 13:113019606-113019628 ACCTGCTTCAAGGAATCCGATGG + Intronic
1114762377 14:25330399-25330421 CCCTGCTACTAGATATAGGAGGG - Intergenic
1118577451 14:67257697-67257719 ACATGTCACTAGAAATATGAAGG + Intronic
1119088388 14:71758064-71758086 TCCTTCTGCTGGAAATATGAGGG - Intergenic
1119170501 14:72531522-72531544 CCCTGCTTTTGTAAATATGAGGG + Intronic
1120155448 14:81088233-81088255 ACCTGCTCCAAGAAACAGGAGGG + Intronic
1124102106 15:26705143-26705165 TCCAGCTTCCAGAAATGTGAAGG - Intronic
1124468878 15:29965620-29965642 ACTATCTTCTAGACATATGATGG + Intronic
1127577314 15:60304189-60304211 ACTTGCTATTAGAAATATGAAGG - Intergenic
1131577185 15:93603822-93603844 TCCTGATTCTACAAACATGATGG - Intergenic
1134663273 16:16000151-16000173 ACCTGCTTCAAAAAAAAGGAAGG - Intronic
1135860956 16:26055516-26055538 ACCTGCTGCTGGAATTATGGTGG + Intronic
1137955216 16:52822706-52822728 AACTGCTTCTAGGAATATCAAGG + Intergenic
1138500953 16:57443940-57443962 ACCTGTTTCTAGAATGATGTTGG + Intronic
1139206743 16:65036393-65036415 ACCTGCTTATATTAATAGGAAGG + Intronic
1139415269 16:66802505-66802527 ACCTACTTCTTGAAATTTTATGG - Intergenic
1144345377 17:14344919-14344941 CACTGCTTCCAGAAATAAGAGGG + Intronic
1144961874 17:19049034-19049056 AGGTGCTTCTAGCCATATGAGGG + Intergenic
1144973287 17:19125488-19125510 AGGTGCTTCTAGCCATATGAGGG - Intergenic
1146202879 17:30875433-30875455 ACCTGCTTAAAGAAAGAAGAGGG - Intronic
1147509886 17:41059026-41059048 ACCTGCGACTCGAAATATGAAGG + Intergenic
1153856789 18:9157101-9157123 CCGTGCTTCTAGAATTAGGATGG + Intronic
1154111901 18:11577436-11577458 AGCTGCTTCTAGAAATAGTAAGG + Intergenic
1158365267 18:56727306-56727328 ACCTGTTTTTAAAAATATCAGGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165662341 19:37592754-37592776 GCCTGTTTACAGAAATATGAAGG + Intronic
1167210786 19:48132995-48133017 ACCTGCGAATACAAATATGACGG - Exonic
926136604 2:10341048-10341070 ACCTGCCTCCAGACACATGAAGG - Intronic
926302434 2:11614025-11614047 ACTAGATGCTAGAAATATGATGG - Intronic
930775130 2:55163439-55163461 CACTGCCTCTAGAAAGATGAGGG - Intergenic
931098858 2:58973099-58973121 ACCTTCTACAAGAAATCTGATGG - Intergenic
933509947 2:83227816-83227838 AACTGGTTCCAGAAAAATGAAGG - Intergenic
935796118 2:106643062-106643084 CCCTGCCTCTAGATGTATGAGGG - Intergenic
939087724 2:137741717-137741739 AACTACTTCCAGAAATATGTTGG - Intergenic
939462674 2:142516884-142516906 AGATGCTTCTAGATTTATGATGG - Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
945764064 2:213951251-213951273 ACAAGCTTTTATAAATATGAAGG - Intronic
946720417 2:222600076-222600098 ACCTACATCTAGAAAAATAAAGG + Exonic
948591567 2:239053952-239053974 ACCTGCTCCCAGAGATAGGAAGG - Intronic
1174690773 20:52502253-52502275 GCCTGCTTTTTGAAATATAAGGG + Intergenic
1176880379 21:14185185-14185207 ACTTTGTTATAGAAATATGAAGG + Intronic
1181035375 22:20167524-20167546 TCCTGCTTCCAGAAAGAAGAAGG + Intergenic
1181895813 22:26106493-26106515 ACCAGGTTCCAGAAATATTATGG - Intergenic
1185219259 22:49621262-49621284 ATTTGTTTCTAAAAATATGATGG - Intronic
949401558 3:3670064-3670086 ACATGCTTGAAGAAATATGTGGG - Intergenic
949677928 3:6478837-6478859 ACATGCTTCAAAAAATAAGAAGG - Intergenic
952861876 3:37819763-37819785 CCCTGCTTCTACACAGATGATGG + Exonic
955416933 3:58701130-58701152 GCTTGCTTTTAGAAATATGGGGG - Intergenic
955988500 3:64600276-64600298 ACCTGCTCCCAGGAAGATGAAGG - Intronic
956919281 3:73909246-73909268 ACATGCTACTACATATATGAAGG + Intergenic
959385113 3:105694565-105694587 ACATCATTTTAGAAATATGATGG - Intronic
959394266 3:105817054-105817076 ACATGTTTTTAGAATTATGAAGG + Intronic
961904972 3:130253511-130253533 TGCTGCTTCTGGAAAAATGATGG + Intergenic
962107727 3:132409695-132409717 ATCTGCTTCTAGAATTACGGAGG + Intergenic
963478699 3:145840011-145840033 ACCTACTTCCAGAAACATCAGGG + Intergenic
964811629 3:160670604-160670626 CGTTTCTTCTAGAAATATGACGG - Intergenic
965127917 3:164653571-164653593 ACCTGCATCCAGAAATGGGAAGG + Intergenic
969266710 4:6069148-6069170 ACCTGCTTCTCAAGAGATGAGGG + Intronic
970160162 4:13180194-13180216 ACCTGCTTTCAGAACTGTGAGGG - Intergenic
970371995 4:15417602-15417624 ACCTGTCTCTACAAATATGGTGG + Intronic
971890281 4:32511050-32511072 ACTTGCTTCAAGGAAAATGAGGG - Intergenic
975671426 4:76784676-76784698 ACCTCCTTCAAGAGATATGTTGG - Intergenic
976636689 4:87293350-87293372 AACTGCTTAAAGAAATAAGATGG - Intergenic
976950967 4:90829910-90829932 ACATGCTACTAGAAAAAGGAAGG - Intronic
982940703 4:161550170-161550192 TTCTGCTTCTAAAAATATTAAGG - Intronic
983302711 4:165947714-165947736 GGGTGCTTCTAGAAATCTGAAGG + Intronic
983611986 4:169656611-169656633 ACCTGCTTCTATTAATTAGAGGG + Intronic
984960987 4:185098550-185098572 ACATGGTTCTAGAAAAATGGAGG + Intergenic
986127595 5:4897775-4897797 ACCAGCTTCTTGAAAGATGGTGG - Intergenic
991559879 5:67939342-67939364 ATTTACTTCTAGAAACATGAGGG - Intergenic
994374150 5:98999360-98999382 AAATGCTTTTAGAAATATGTAGG - Intergenic
995549795 5:113269413-113269435 ACATTATTCTAGAGATATGAAGG - Intronic
999615424 5:153417895-153417917 GCCAGTTGCTAGAAATATGATGG + Intergenic
1002590691 5:180290166-180290188 ACCTTCTTCTAGAAAACTGCTGG + Intronic
1005284115 6:24306054-24306076 AAATGCTACTTGAAATATGAGGG + Intronic
1006322515 6:33328522-33328544 ACCTACTTAAAGATATATGAAGG + Intronic
1008551292 6:52634016-52634038 ACATTTTTCTAGAAATTTGAAGG + Intergenic
1008960720 6:57262815-57262837 ACCTCCTTCTAGAAAGACGGTGG - Intergenic
1010016404 6:71109551-71109573 ACCTGGTTCTAGAAGCATGCAGG - Intergenic
1013729016 6:113140868-113140890 ACCAGCTTTTATAACTATGAGGG + Intergenic
1013850317 6:114505614-114505636 ACCTGCTTATAGTAAAATGAGGG - Intergenic
1016336741 6:143014045-143014067 ACCTCTTTCTAAAAATATGCAGG + Intergenic
1016622688 6:146130823-146130845 ATCTCCTTCTAGAAATTAGAAGG - Intronic
1016998513 6:149977996-149978018 ACCTGCTTGCAGAAAGAAGAAGG + Intergenic
1018833525 6:167465123-167465145 AACTGCATCCAGAAAGATGAAGG - Intergenic
1027957852 7:84904649-84904671 ACCTGCTTATAAGAATATGAAGG - Intergenic
1028726440 7:94092843-94092865 ACTTGCTTCAAAAAATATGGAGG + Intergenic
1029011587 7:97267623-97267645 ATCTGCTTCTGGCAATGTGAGGG + Intergenic
1031608980 7:123802755-123802777 ATCTGCTTATAAAAATAAGATGG + Intergenic
1031884402 7:127230798-127230820 TCCAGCTTCCAGAAATGTGAGGG + Intronic
1037248227 8:16861893-16861915 ACCTGCTTAGAGAAATGTTATGG + Intergenic
1037559424 8:20059359-20059381 AACTGCCTCTAGAAAAATGTTGG + Intergenic
1040744490 8:50624562-50624584 TACTGCTACTAGAAATATAATGG + Intronic
1040874347 8:52135032-52135054 ACTTGCTTCTAGAAAAATGTTGG - Intronic
1041990534 8:63984853-63984875 ACCTGGTGCTAAAAATAGGATGG + Intergenic
1042034660 8:64518721-64518743 AACGGCTTCTAGAAAAATTAAGG - Intergenic
1044113916 8:88310843-88310865 TCCTGTGTCTAGAAATATGTAGG - Intronic
1045445389 8:102257012-102257034 ACTTTCTTGTAGAAATTTGAAGG - Intronic
1046776790 8:118172941-118172963 CTCTGCTTCTAGGAATTTGATGG + Intergenic
1046943093 8:119950284-119950306 TACTGCTTCCACAAATATGAGGG + Intronic
1047028333 8:120849131-120849153 AGCTCCTTTTAGAAAAATGAAGG - Intergenic
1047657383 8:126992679-126992701 TCCTGCTTTTAGAAACATCAGGG - Intergenic
1055801122 9:80037514-80037536 TGCTGCTTCTTGAAATATGATGG + Intergenic
1059204137 9:112447570-112447592 ACCTGCCTTTGGAAACATGAAGG + Intronic
1059565029 9:115375700-115375722 ACGTGTTGTTAGAAATATGAGGG + Intronic
1060450561 9:123734745-123734767 ACTTGGTTCTAGACATATGATGG + Intronic
1061271549 9:129546605-129546627 TCCTGCTTCCAGAAACATCACGG + Intergenic
1203407522 Un_KI270538v1:56617-56639 ATCTGCTTCTGGATATTTGAAGG - Intergenic
1203407770 Un_KI270538v1:61418-61440 ATCTGCTTCTGGATATTTGAAGG - Intergenic
1185665594 X:1762947-1762969 ACCTCATTCTAGATATAAGAAGG + Intergenic
1186103455 X:6181098-6181120 AGCTGCTATCAGAAATATGAGGG + Intronic
1187230174 X:17414449-17414471 ATTTGCTTCTAAAAATATGTGGG + Intronic
1188012874 X:25075968-25075990 ACCAGCTTCTCAAAGTATGAAGG - Intergenic
1189014460 X:37081999-37082021 AACTACTTCAAGAAATATGAAGG + Intergenic
1194227784 X:91282514-91282536 ACCTGCCTTTGGTAATATGAAGG + Intergenic
1194932914 X:99910413-99910435 ACCTGATTGTAGAAATTTGGTGG + Intergenic
1195449068 X:104989387-104989409 ACCTGCTGCTAGAAATAAACGGG + Intronic
1195791168 X:108588181-108588203 ACATGCATCTAGAAATCTTACGG - Intronic
1196562345 X:117165371-117165393 ACATGCTACTAATAATATGAAGG + Intergenic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1198888000 X:141360637-141360659 ACCTGTTTTTACAAATGTGAAGG - Intergenic
1200480940 Y:3702038-3702060 ACTTTCTTCAAGAATTATGAGGG - Intergenic
1201543128 Y:15131449-15131471 AACTCCTTCTAGAAATATCATGG + Intergenic