ID: 918374996

View in Genome Browser
Species Human (GRCh38)
Location 1:183900184-183900206
Sequence CATGGTCAGGTCAGTCAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374996_918375005 23 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375005 1:183900230-183900252 CATCGAGGTGAGTTCCATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
918374996_918375000 -4 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375000 1:183900203-183900225 CATGCTTGACACTGCCCTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 131
918374996_918375001 8 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375001 1:183900215-183900237 TGCCCTTCAGGACTACATCGAGG 0: 1
1: 0
2: 0
3: 4
4: 60
918374996_918375004 22 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375004 1:183900229-183900251 ACATCGAGGTGAGTTCCATGTGG 0: 1
1: 0
2: 0
3: 6
4: 68
918374996_918375006 26 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918374996 Original CRISPR CATGGTCAGGTCAGTCAGGA AGG (reversed) Exonic