ID: 918374999

View in Genome Browser
Species Human (GRCh38)
Location 1:183900202-183900224
Sequence CTGAAGGGCAGTGTCAAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374999_918375005 5 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375005 1:183900230-183900252 CATCGAGGTGAGTTCCATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
918374999_918375008 18 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918374999_918375006 8 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374999_918375004 4 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375004 1:183900229-183900251 ACATCGAGGTGAGTTCCATGTGG 0: 1
1: 0
2: 0
3: 6
4: 68
918374999_918375007 17 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375007 1:183900242-183900264 TTCCATGTGGGTGGTGTGATCGG 0: 1
1: 0
2: 1
3: 16
4: 199
918374999_918375001 -10 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375001 1:183900215-183900237 TGCCCTTCAGGACTACATCGAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918374999 Original CRISPR CTGAAGGGCAGTGTCAAGCA TGG (reversed) Exonic