ID: 918375002

View in Genome Browser
Species Human (GRCh38)
Location 1:183900217-183900239
Sequence CACCTCGATGTAGTCCTGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918375002_918375005 -10 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375005 1:183900230-183900252 CATCGAGGTGAGTTCCATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
918375002_918375008 3 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375002_918375007 2 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375007 1:183900242-183900264 TTCCATGTGGGTGGTGTGATCGG 0: 1
1: 0
2: 1
3: 16
4: 199
918375002_918375006 -7 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375002_918375010 22 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375002 Original CRISPR CACCTCGATGTAGTCCTGAA GGG (reversed) Exonic