ID: 918375003

View in Genome Browser
Species Human (GRCh38)
Location 1:183900218-183900240
Sequence TCACCTCGATGTAGTCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918375003_918375006 -8 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375003_918375010 21 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234
918375003_918375007 1 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375007 1:183900242-183900264 TTCCATGTGGGTGGTGTGATCGG 0: 1
1: 0
2: 1
3: 16
4: 199
918375003_918375008 2 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375003 Original CRISPR TCACCTCGATGTAGTCCTGA AGG (reversed) Exonic