ID: 918375003

View in Genome Browser
Species Human (GRCh38)
Location 1:183900218-183900240
Sequence TCACCTCGATGTAGTCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918375003_918375007 1 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375007 1:183900242-183900264 TTCCATGTGGGTGGTGTGATCGG 0: 1
1: 0
2: 1
3: 16
4: 199
918375003_918375006 -8 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375003_918375008 2 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375003_918375010 21 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375003 Original CRISPR TCACCTCGATGTAGTCCTGA AGG (reversed) Exonic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
905414718 1:37795828-37795850 TCACCTGGATGCTGTACTGATGG - Exonic
908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG + Intronic
911542531 1:99175362-99175384 TCATCTTGATTTAGTTCTGATGG - Intergenic
913596777 1:120386243-120386265 TAACTTCTCTGTAGTCCTGAGGG + Intergenic
914090493 1:144492738-144492760 TAACTTCTCTGTAGTCCTGAGGG - Intergenic
914308114 1:146441484-146441506 TAACTTCTCTGTAGTCCTGAGGG + Intergenic
914593994 1:149131649-149131671 TAACTTCCCTGTAGTCCTGAGGG - Intergenic
917609113 1:176668238-176668260 TCACCTATATGTATCCCTGAAGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
1064190023 10:13197706-13197728 TCACCTCCAGGATGTCCTGAGGG - Exonic
1068382548 10:56275652-56275674 TTACCTGGAGGTAGTTCTGATGG + Intergenic
1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG + Intronic
1075623619 10:123946271-123946293 TCACCTCCATGTAGTCCCTTGGG - Intergenic
1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG + Intronic
1101612598 12:106304637-106304659 TGACCTCGATCTAGTGTTGAAGG + Intronic
1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG + Intergenic
1112564314 13:100539935-100539957 CCACCTCGATTTAGACCTGCGGG - Intronic
1121866997 14:97371777-97371799 TCCCCTCCATGCAGTCCTGCTGG - Intergenic
1132543134 16:520767-520789 TCCTGTCGATGTAGTCCTGCAGG - Exonic
1133579161 16:7126327-7126349 CCACCTCGATTTAGACCTGCGGG - Intronic
1136298368 16:29316741-29316763 TGACCTGGAGGTAGTCCTGCAGG + Intergenic
1146481996 17:33212270-33212292 TGATCTCAATGTAGTCCTGAGGG + Intronic
1148427534 17:47612461-47612483 TCATCTCGATGCACTCCTGAGGG + Exonic
1155685420 18:28542507-28542529 TCATCTTGATATAGTCCTGAAGG + Intergenic
1160765137 19:804285-804307 TCATCTCGATGAAGGCCTGTTGG - Exonic
1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG + Intronic
927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG + Intergenic
934551072 2:95261922-95261944 ACACCTCCATGTAGCTCTGAAGG - Intergenic
935952857 2:108346597-108346619 TCACCAAGATGTTTTCCTGATGG - Intergenic
940409938 2:153349825-153349847 TCACCTCCCTCTAGTGCTGAAGG - Intergenic
946201957 2:218075722-218075744 TCACCTTGATCTCGTCCTGCAGG - Exonic
946371810 2:219285758-219285780 TCACCTCTGCCTAGTCCTGAGGG - Exonic
1170065832 20:12309448-12309470 CAACCTCAATCTAGTCCTGAAGG - Intergenic
1173105628 20:40130932-40130954 TCACATCGATGGTGACCTGAGGG + Intergenic
1174975487 20:55328495-55328517 TCACCTCCATGCAGTTCTCAAGG + Intergenic
954717248 3:52533021-52533043 ACACCTCGATGTCGCCCTGGAGG - Intronic
955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG + Intronic
959394937 3:105825107-105825129 TAACCTAGATGCAGTCCTCATGG - Intronic
960044942 3:113187491-113187513 TCCCCTCATTGAAGTCCTGAAGG + Intergenic
967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG + Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
977183228 4:93903914-93903936 TCTCCTGGATGTAGTGCTGCTGG - Intergenic
990482995 5:56229697-56229719 CCACCTCGTTGGAGCCCTGAAGG + Intronic
1001357422 5:171042368-171042390 TCAACTCCATGTAATCCTAAGGG + Intronic
1001641344 5:173246172-173246194 TCACCTCGTCGCAGTCCGGAAGG - Intergenic
1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG + Exonic
1015607963 6:134979956-134979978 TTACCTAGACATAGTCCTGAAGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG + Intergenic
1061667105 9:132166966-132166988 TCACCTTGACGTAGTCCTTCAGG - Exonic
1186674313 X:11799864-11799886 TCTTCTCCATGTAGTCCTCATGG - Intergenic
1188702503 X:33282226-33282248 CCACCTCGATGTCTTCCTGTCGG + Intronic
1195906947 X:109853415-109853437 TCACTGCAATGTAATCCTGAAGG - Intergenic