ID: 918375006

View in Genome Browser
Species Human (GRCh38)
Location 1:183900233-183900255
Sequence CGAGGTGAGTTCCATGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374998_918375006 13 Left 918374998 1:183900197-183900219 CCTGACCATGCTTGACACTGCCC 0: 1
1: 0
2: 1
3: 6
4: 171
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375002_918375006 -7 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374999_918375006 8 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374997_918375006 22 Left 918374997 1:183900188-183900210 CCTGACTGACCTGACCATGCTTG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374996_918375006 26 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375003_918375006 -8 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375006 Original CRISPR CGAGGTGAGTTCCATGTGGG TGG Exonic