ID: 918375006

View in Genome Browser
Species Human (GRCh38)
Location 1:183900233-183900255
Sequence CGAGGTGAGTTCCATGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374998_918375006 13 Left 918374998 1:183900197-183900219 CCTGACCATGCTTGACACTGCCC 0: 1
1: 0
2: 1
3: 6
4: 171
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374999_918375006 8 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374997_918375006 22 Left 918374997 1:183900188-183900210 CCTGACTGACCTGACCATGCTTG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375003_918375006 -8 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918375002_918375006 -7 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96
918374996_918375006 26 Left 918374996 1:183900184-183900206 CCTTCCTGACTGACCTGACCATG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375006 Original CRISPR CGAGGTGAGTTCCATGTGGG TGG Exonic
903318276 1:22525856-22525878 AGAGGTGAGTGCCATGTGAGAGG - Intronic
904258082 1:29269661-29269683 CGAGGGGAGTTTCATGGGGATGG - Intronic
908916193 1:69129432-69129454 AGAGGTGAATTTCATGTGAGTGG + Intergenic
910261733 1:85299561-85299583 GGAAGTGAGTTACATCTGGGGGG + Intergenic
910558425 1:88563141-88563163 GGAGGTGAGTTGGATGTGAGAGG - Intergenic
915633977 1:157173740-157173762 CCAGGTGAGCTGCATGTGGAAGG + Intergenic
918375006 1:183900233-183900255 CGAGGTGAGTTCCATGTGGGTGG + Exonic
920186458 1:204162274-204162296 AGAGGTGATTTCCAGGTGGCTGG - Intronic
923095358 1:230771123-230771145 GCAGGTGAGTTCCTTGTAGGGGG - Intronic
1062768632 10:83259-83281 CCAGGTGACATCCTTGTGGGAGG - Intergenic
1063584970 10:7344215-7344237 GAAGGTGAGTTCCGTGTGGGTGG + Intronic
1066713381 10:38260933-38260955 CAAGCTGAGTTCCATTAGGGAGG + Intergenic
1067722035 10:48735116-48735138 CAAGGTGATTTCCATGTCAGAGG + Intronic
1070406827 10:76104788-76104810 AGAGGGGGGTTCCATATGGGGGG - Intronic
1077264919 11:1643655-1643677 CGGGGTGGGGTGCATGTGGGCGG + Intergenic
1082767372 11:57180363-57180385 TGGGGTGATTTCCAGGTGGGCGG + Intergenic
1083779269 11:64909694-64909716 GCAGGTGAGTTCCAGGTGGGTGG + Exonic
1084416049 11:69033588-69033610 CGAGATGAGTTCCCTCTGGCAGG + Intergenic
1084947234 11:72644687-72644709 AGAGGTGAGTGCCATGGAGGTGG - Intronic
1088601402 11:111480084-111480106 CGAGGTGAGTTTCTTGTAGATGG - Intronic
1088808255 11:113370972-113370994 CGAGATGAATTCCGTGTGTGTGG - Intronic
1088928233 11:114323484-114323506 CGAAGGAAGTTCCATGTGGCTGG + Intergenic
1096241502 12:49962377-49962399 CGCGGTGAGTGCCCTGGGGGGGG + Exonic
1096581261 12:52587028-52587050 AGAGGTGACTTCCAGGTGGTTGG - Intronic
1106449497 13:29867165-29867187 CCAGGTGACTTCCATGTGTCAGG + Intergenic
1106865411 13:33959179-33959201 GGAGGTGGCTTACATGTGGGAGG - Intronic
1118642724 14:67807515-67807537 CGAGGGGAGTCCCCTGCGGGAGG - Exonic
1121018039 14:90560279-90560301 CGAGGTGATGTCATTGTGGGTGG + Intronic
1121856377 14:97273902-97273924 AGTGGTGGGTTGCATGTGGGAGG - Intergenic
1122542665 14:102506774-102506796 TCAGGTGAGTTCCAAGTGGCAGG - Exonic
1125760556 15:42093258-42093280 CGAGGTGCTTTCCAGGTGTGGGG + Intronic
1130359070 15:83164230-83164252 AGAGTTGACTTCCATGTGGTGGG - Intronic
1130723006 15:86408462-86408484 GCAGTTGAGTTCCATGTGGAAGG - Intronic
1132457496 16:32280-32302 CCAGGTGACATCCTTGTGGGAGG - Intergenic
1132780442 16:1621526-1621548 GAAGGTGGGTTCCATTTGGGAGG + Intronic
1133316549 16:4888083-4888105 AGAGGTGAGTTCCATGGGCCAGG - Exonic
1134056441 16:11173121-11173143 CGAGTTGAGTGGCATGTGGGTGG - Intronic
1134230410 16:12424702-12424724 CGAGTGGAGTTCTATCTGGGGGG + Intronic
1146401608 17:32504294-32504316 TGAGGAGAGTGCCATGGGGGAGG - Intronic
1147320885 17:39645247-39645269 AGAGGTGAATTCCAGGTTGGGGG - Intronic
1149766530 17:59283511-59283533 TGAGTTGTGTTCTATGTGGGAGG + Intergenic
1203162068 17_GL000205v2_random:62439-62461 GGAGGTGAGTCACATGTGGCAGG - Intergenic
1152961513 18:83089-83111 CCAGGTGACATCCTTGTGGGAGG - Intergenic
1153125299 18:1784234-1784256 CCATTTGAGTTCCTTGTGGGAGG + Intergenic
1153621384 18:6981418-6981440 TGAGTTGAGTTCCAGTTGGGTGG - Intronic
1155147250 18:23094362-23094384 AGAGGGGAGTTACATTTGGGAGG + Intergenic
1156018967 18:32578357-32578379 TGAGGTGAGTTCTATGACGGTGG + Intergenic
1157501141 18:48191518-48191540 GGAGGTGAGCTCCATGGTGGCGG + Intronic
1160543548 18:79638392-79638414 CCTGGTGGGTTCCAGGTGGGAGG + Intergenic
1161096804 19:2396728-2396750 GGAGGTGCTTTCCGTGTGGGAGG + Intronic
1161355064 19:3814486-3814508 AGAGGTGCGTTTCAGGTGGGAGG - Intronic
1161485821 19:4535146-4535168 CCAGGTGAGTGCCCTGAGGGCGG - Exonic
1167679474 19:50910273-50910295 TGAGGTGAGTTCCTTGGGGATGG + Intronic
926620302 2:15041220-15041242 AGAGCTGAGTCCCATGGGGGAGG + Intergenic
928222856 2:29419464-29419486 GGAGGTGAGGTCCTTCTGGGTGG + Intronic
931461157 2:62451217-62451239 CGATGTGAGCTCCTTGTGAGCGG + Intergenic
932432463 2:71684175-71684197 CGAGGTGTGTACGATGTGGGAGG + Intronic
932445545 2:71778766-71778788 GGAGCTGGGTTTCATGTGGGTGG + Intergenic
935351465 2:102154848-102154870 AGAGGTGGGTTCCGAGTGGGAGG - Intronic
940325173 2:152417692-152417714 GGAGGTGAGTTACATGTCAGAGG - Intronic
947979771 2:234398943-234398965 CTAGGTGCTTTCCCTGTGGGGGG + Intergenic
948003558 2:234589178-234589200 CGAGGACAGTACCGTGTGGGGGG + Intergenic
948838320 2:240636868-240636890 TGAGGTGAGCTCCTCGTGGGTGG - Intergenic
1168948216 20:1778730-1778752 CCAGGTGAGTCGCAGGTGGGCGG + Intergenic
1173241163 20:41298635-41298657 AGAGGGGAGTTCCATGAGAGTGG + Intronic
1181027000 22:20132249-20132271 CGGGGTGAGTCCCTTGTGTGGGG + Intronic
1181778087 22:25174317-25174339 CGAGGTGGGCTCCGTTTGGGAGG - Exonic
1182938964 22:34255403-34255425 CCATTTGAGTTCCTTGTGGGAGG - Intergenic
1185202066 22:49513682-49513704 AGAGTTGAGTTGCCTGTGGGTGG - Intronic
951035176 3:17925143-17925165 GGAGGTGACTGCCATGTTGGAGG + Intronic
954139346 3:48596799-48596821 CAAGGTGTGCTCCAGGTGGGGGG + Intergenic
957549009 3:81680015-81680037 AGAACTGAGTTCCATGTGGTGGG - Intronic
966010805 3:175074031-175074053 AGAAGTGAGTTCCATAAGGGTGG + Intronic
966183060 3:177204208-177204230 CAGCGTGAGTTCCAAGTGGGCGG - Intergenic
968094256 3:195916885-195916907 TGAGGTGACTTCCATGTGAGTGG + Intergenic
969456893 4:7305470-7305492 GGAGCTGAGCGCCATGTGGGAGG - Intronic
969473237 4:7402269-7402291 AGAGGTTACTTCCAGGTGGGTGG - Intronic
969497603 4:7534998-7535020 GGAGGCCAGTTCCATCTGGGTGG - Intronic
971906436 4:32732367-32732389 CCTGCTGAGTTCCATGGGGGAGG + Intergenic
980655416 4:135776594-135776616 CGTGGTGAGTTCCTTGTTGGTGG + Intergenic
989084095 5:37656922-37656944 CTTGCTGAGTTCCATGGGGGCGG + Intronic
991655031 5:68895525-68895547 AGAGGTCAGTTCCATGAGGCGGG - Intergenic
1000984016 5:167847330-167847352 GGAAGTGAGTTCACTGTGGGTGG - Intronic
1002689218 5:181038637-181038659 GGAGGTGATTAGCATGTGGGAGG - Intergenic
1005939028 6:30547093-30547115 GAAGGTGAGTTCCATGTGCCTGG - Exonic
1008315932 6:50040836-50040858 TGAACTGAGATCCATGTGGGCGG - Intergenic
1013602148 6:111715058-111715080 AGAGGTGAGTTCAAGGTAGGGGG - Intronic
1014397710 6:120946472-120946494 AGAGGGGAGCTTCATGTGGGTGG - Intergenic
1017870641 6:158483693-158483715 CCAGGTGATTTGCATGGGGGTGG - Intronic
1017920805 6:158870296-158870318 GGAGATCAGTTCCAGGTGGGAGG + Intronic
1020150342 7:5677002-5677024 CGAGGTTCGTTTCATGTGGTTGG - Intronic
1022223346 7:28337594-28337616 TGAAGTGTGTTCCATGTAGGCGG + Intronic
1022795014 7:33725022-33725044 AGAGGTGAGTGCCATGTGATTGG - Intergenic
1023173170 7:37409628-37409650 CGTGGAGAGTCCCAAGTGGGAGG - Intronic
1033780902 7:144667824-144667846 CGAGGAGAGTTTCAAGTTGGAGG + Intronic
1036660961 8:10708367-10708389 CATGGAGAGGTCCATGTGGGAGG - Intronic
1037825047 8:22155895-22155917 CGAGCTGAGTGCCAAGTGGCTGG + Intronic
1038732782 8:30142045-30142067 CTAGGGGAGTTGCCTGTGGGTGG - Intronic
1062600528 9:137316899-137316921 CCAGGGGAGCTCTATGTGGGAGG + Intronic
1062664983 9:137665572-137665594 TGAGTTGAGTTCCTTGTGAGAGG + Intronic
1189588738 X:42489273-42489295 TGAGGTGAGTACCCTGAGGGAGG - Intergenic
1191601788 X:63016834-63016856 CGTGCTGGGTTCCATGGGGGTGG + Intergenic
1193350833 X:80462696-80462718 CTTGCTGGGTTCCATGTGGGTGG - Intergenic
1200398861 X:156007101-156007123 CCAGGTGACATCCTTGTGGGAGG + Intronic