ID: 918375008

View in Genome Browser
Species Human (GRCh38)
Location 1:183900243-183900265
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374999_918375008 18 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375003_918375008 2 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375002_918375008 3 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918374998_918375008 23 Left 918374998 1:183900197-183900219 CCTGACCATGCTTGACACTGCCC 0: 1
1: 0
2: 1
3: 6
4: 171
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type