ID: 918375008

View in Genome Browser
Species Human (GRCh38)
Location 1:183900243-183900265
Sequence TCCATGTGGGTGGTGTGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918374998_918375008 23 Left 918374998 1:183900197-183900219 CCTGACCATGCTTGACACTGCCC 0: 1
1: 0
2: 1
3: 6
4: 171
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375002_918375008 3 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918374999_918375008 18 Left 918374999 1:183900202-183900224 CCATGCTTGACACTGCCCTTCAG 0: 1
1: 0
2: 2
3: 15
4: 274
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132
918375003_918375008 2 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG 0: 1
1: 0
2: 1
3: 29
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375008 Original CRISPR TCCATGTGGGTGGTGTGATC GGG Intronic
900681998 1:3921837-3921859 TCGATGTGGGTGGTGGTTTCAGG - Intergenic
901735446 1:11309438-11309460 TCCAAGTGGTGGGTGTGATATGG - Intergenic
904114402 1:28150993-28151015 TCCATGTGGGAGGAGTCATGTGG + Exonic
904302182 1:29561461-29561483 CCCCTGTGGGCTGTGTGATCTGG + Intergenic
904401238 1:30258029-30258051 CCCCTGTGGGCTGTGTGATCTGG - Intergenic
904455083 1:30642676-30642698 CCCCTGTGGGCTGTGTGATCTGG - Intergenic
905030748 1:34882862-34882884 TCCATGTGGCTGGTGTGGAGTGG - Intronic
905672169 1:39799011-39799033 TCCACGTGGGCCGTGTGACCTGG + Intergenic
907330887 1:53670568-53670590 TTCATGTGGCTGGTGTGTTAGGG - Intronic
909718276 1:78736496-78736518 TCCTTGTGACTGATGTGATCAGG + Intergenic
912074237 1:105851827-105851849 TCAATGTTGGGGGTGTGGTCTGG + Intergenic
916838127 1:168570300-168570322 TCCATCTGGGAAGTGTAATCTGG - Intergenic
918178897 1:182069213-182069235 CGCATGTAGGTGGTGTGACCTGG - Intergenic
918375008 1:183900243-183900265 TCCATGTGGGTGGTGTGATCGGG + Intronic
918987054 1:191645213-191645235 TCCTTGTGGTTGGTATGTTCTGG - Intergenic
923046746 1:230361487-230361509 CCCAGGTAGGTGGTGTGATGGGG - Intronic
923435148 1:233960959-233960981 TCCATGAGGTTGTTTTGATCTGG - Intronic
1070850432 10:79558522-79558544 TCCAGGCAGATGGTGTGATCAGG - Intronic
1072767397 10:98106700-98106722 TCCATTTGGGTGGTGTCAGCTGG - Intergenic
1076921170 10:133455525-133455547 TCCATGTGGGTGGTGCTGTGTGG - Intergenic
1077318834 11:1931752-1931774 TTCATTTGCGTGGTGTCATCTGG + Intronic
1079683866 11:23332018-23332040 GACCTGTGGGTGGTGTGCTCTGG + Intergenic
1080807064 11:35663094-35663116 GCCATGTGGGTGCTGTGACGCGG - Exonic
1081732352 11:45380473-45380495 CCCGTGTGGGTTGTGTGACCTGG + Intergenic
1083676239 11:64326721-64326743 GCCATGAAGGTGCTGTGATCAGG + Intergenic
1084007096 11:66328935-66328957 TCCATTTGCATGGCGTGATCTGG - Intergenic
1084288441 11:68146670-68146692 TCCATGTGGCTGGAGGGCTCAGG + Intergenic
1084326367 11:68402679-68402701 TCTGTGTGGTGGGTGTGATCTGG + Intronic
1085760061 11:79233914-79233936 GCCATGTGGGAGGTGAGTTCAGG - Intronic
1091658925 12:2367082-2367104 TCCATGAGACTGGTGTGATATGG - Intronic
1094809095 12:34120713-34120735 CCCATTCGGGTGGGGTGATCTGG + Intergenic
1096179288 12:49541770-49541792 TGCATGTAGGTGCTGTGGTCGGG + Intronic
1103522701 12:121547050-121547072 CCCATTTGGCTGGTGTCATCAGG - Intronic
1106121878 13:26866661-26866683 TGCATGAGTGTGGTGTGCTCAGG - Intergenic
1107454905 13:40546128-40546150 TTCATTTGGGTGGTGTCCTCAGG - Intergenic
1112192764 13:97193871-97193893 ATGATGTGGGAGGTGTGATCAGG - Intergenic
1113028286 13:105965052-105965074 TCCAGGTGGGTTCTGTAATCAGG - Intergenic
1114625486 14:24126524-24126546 TGGATGTGGGTGGTGTGTGCTGG - Intronic
1117263685 14:54063515-54063537 CCCATGTTGTTGGTGTGATGTGG - Intergenic
1119420117 14:74503356-74503378 TCCATGTGGATGTCGTGGTCAGG + Exonic
1122032342 14:98921587-98921609 TCCATGTGGGTGATATGGTTTGG - Intergenic
1122112024 14:99509898-99509920 TGCCTGTAGGTGGTGTGGTCAGG + Exonic
1122849580 14:104520413-104520435 TTCATGTAGGAGGTGTGATGTGG + Intronic
1123012763 14:105357273-105357295 ACGATGTGGCTGGTGTGACCTGG - Intronic
1123137124 14:106038282-106038304 TTCATGTGAGTGCTGTGGTCAGG - Intergenic
1123954817 15:25324382-25324404 TCCCAGTGGCTGGTGTCATCGGG + Intergenic
1126630226 15:50727250-50727272 TCCATGTGGGTGGGGTGCACAGG + Intronic
1128451729 15:67809829-67809851 TGCATGTGGGTGATGTAATTTGG - Intergenic
1129333824 15:74840869-74840891 TGCAGGTAGCTGGTGTGATCAGG - Intronic
1132676902 16:1124697-1124719 TCCATGTGGGTGGGGGCTTCTGG - Intergenic
1134061257 16:11200991-11201013 TCCATCTGGGTGGTCTGTGCTGG + Intergenic
1134390612 16:13816647-13816669 TCCATGTGGGTGGTTTTCTCTGG - Intergenic
1134753729 16:16648013-16648035 TCCATGTGGATTCTGTCATCTGG - Intergenic
1134992330 16:18711030-18711052 TCCATGTGGATTCTGTCATCTGG + Intergenic
1138030248 16:53554056-53554078 TCAGTCTGGGTGGTGTGATGGGG + Intergenic
1138600612 16:58051846-58051868 TCCATGGGGGTGGGGAGGTCAGG - Intergenic
1138771575 16:59670872-59670894 TCTATCTGGGTGGTGTCAGCTGG + Intergenic
1140879152 16:79182094-79182116 TCCAGCTGGCTGGTGTGAGCAGG - Intronic
1141686118 16:85570928-85570950 TCCTTTTGGCTGGAGTGATCTGG + Intergenic
1141944179 16:87298292-87298314 TCCAGGTGGGTGGGGTTATTTGG - Intronic
1142383060 16:89744935-89744957 TACGTGTGGGTGGTGAGATGGGG - Intronic
1143354240 17:6313516-6313538 TCATTGGGAGTGGTGTGATCTGG + Intergenic
1143433390 17:6903498-6903520 TCCATGTGGAAGGTGTCCTCTGG + Intronic
1143697481 17:8630903-8630925 TCCAGGTGGGTGGAGGGAGCCGG - Intergenic
1146136956 17:30330665-30330687 TCTTTGTGGGTTGGGTGATCAGG + Intronic
1148465300 17:47861298-47861320 GCCCTGTGGGTGGTAGGATCAGG - Intergenic
1152616561 17:81340688-81340710 TCCAGGTGGGTGGGGTGTCCAGG + Intergenic
1165551994 19:36594753-36594775 TTTGTGTGTGTGGTGTGATCAGG - Intronic
1167462156 19:49631171-49631193 GGCATGTGGATGGTGAGATCTGG + Intergenic
926665497 2:15517796-15517818 ACCATGAGGGTAATGTGATCAGG - Intronic
932298561 2:70646674-70646696 TTCATGAGGGTGGAGTGAGCGGG + Intronic
935987727 2:108690752-108690774 TCCATGCAGGAGCTGTGATCAGG - Intergenic
936126555 2:109793456-109793478 TCCATGCAGGAGCTGTGATCAGG - Intronic
936218138 2:110578012-110578034 TCCATGCAGGAGCTGTGATCAGG + Intergenic
937308213 2:120885135-120885157 TCCCTGGGGGTGATGAGATCGGG - Intronic
938212877 2:129483359-129483381 TTCATCTGGGAGATGTGATCTGG - Intergenic
939433074 2:142136001-142136023 TCCATGTGAGTGGAGTGACAAGG - Intergenic
941442421 2:165554902-165554924 CAGATGTGGGTGATGTGATCGGG - Intronic
943340533 2:186675218-186675240 TCCATGGGGATGTTGAGATCTGG + Intronic
943683231 2:190789678-190789700 TCCCTGTGGGTGGAGGGAGCTGG - Intergenic
943769169 2:191696163-191696185 TCCATGTGTCTGGTGTAAGCAGG - Intronic
943983868 2:194594242-194594264 TCAATTTGGGTGGTGTCAACTGG - Intergenic
1168995144 20:2127615-2127637 ACCATGTCAGTGGTGTCATCTGG - Intronic
1170917048 20:20637022-20637044 TCCTTGTGGGTGGTGGGGTATGG - Intronic
1173766022 20:45610073-45610095 TCCCTGTGGGTGGTGTGAAAAGG - Exonic
1174514655 20:51082657-51082679 TCTTTCTGGGTTGTGTGATCTGG - Intergenic
1175295724 20:57907558-57907580 TCCTTGTGGGCGGTGGGACCGGG - Intergenic
1175711943 20:61228320-61228342 TGCATGTGGGTGATCTGAACAGG - Intergenic
1179475160 21:41638448-41638470 TCCATGTGGCTGCTGTTAGCTGG + Intergenic
1179841918 21:44081902-44081924 TCCATGTGGGTGGGTTTCTCGGG + Intronic
1179881619 21:44295465-44295487 TCCAGATGGGTGGTGTGAGGAGG - Intronic
1181580921 22:23827655-23827677 TCCATCTGGCTGCTGTGATAGGG - Intronic
1181932249 22:26411552-26411574 TCCATGAGGCTGGTGTGGTCAGG - Intergenic
1182277744 22:29201148-29201170 TCCATGTGGTTGGACGGATCTGG - Intergenic
1185289424 22:50016146-50016168 ACCAAGTGGGTGGTGGGTTCAGG + Intronic
949211461 3:1507945-1507967 CCCATCTAGGTGGGGTGATCAGG + Intergenic
949797777 3:7869589-7869611 TCCATGTGGCTGGTGTGCAGTGG - Intergenic
950440246 3:13006313-13006335 GCCATGTGGAAGGTGTGATTGGG + Intronic
950787378 3:15447926-15447948 TCCACTGGGGTGGGGTGATCAGG - Intronic
953469303 3:43153703-43153725 GCCATGTGGGTGATGTCATGGGG + Intergenic
954754226 3:52830520-52830542 TCCATGGGTGTGGCGTGAGCTGG - Intronic
954871745 3:53772632-53772654 TGCATGTGGATGGTGTCTTCAGG + Intronic
955682559 3:61517661-61517683 TCCAAGTGGATGGTGGGATAGGG + Intergenic
955792961 3:62607460-62607482 TCCATGTGGGAGGCTCGATCGGG - Intronic
958611497 3:96432180-96432202 TCCTGGTGGGTGGTGTGCCCAGG + Intergenic
959543093 3:107563097-107563119 CCCATGTGGGAGGAGTGCTCAGG + Intronic
961489598 3:127245358-127245380 TCCATGTGGGTGGTGTGCCTGGG - Intergenic
969028247 4:4191490-4191512 GCCATGTGGGTGGGGTGAGTGGG - Intronic
977020038 4:91747120-91747142 TCCAGGTGGAGGGTGTGATGGGG + Intergenic
977020113 4:91747515-91747537 TCCAGTTGGGTTGTGTGTTCTGG + Intergenic
978250276 4:106622554-106622576 TCCATGTGGGTGATGTGCATGGG - Intergenic
980727421 4:136782350-136782372 TCCATGTGTGAGGTGTGATCAGG + Intergenic
983880920 4:172931619-172931641 TCCATGTGGGTGGAGAGAACTGG - Intronic
985190135 4:187363722-187363744 TCCATGTGTCTGGGGTCATCTGG - Intergenic
986132461 5:4943607-4943629 TCCAGGTGGTTGGTTTGATTTGG + Intergenic
988116015 5:26892004-26892026 TCAAGGTGGGCGGTGTGAACAGG - Intronic
989984486 5:50681776-50681798 TCCATGTGGTTGCTGTCAACTGG + Intronic
990714743 5:58624248-58624270 TCCCTGTGTGTGCTGTGCTCAGG - Intronic
991996358 5:72391024-72391046 TCCATGTGGGTTGTCTGAAGAGG + Intergenic
994846531 5:104995292-104995314 TCCATCTGGCTGGTGTGAGATGG + Intergenic
998558497 5:143149137-143149159 TCCCTCTGGGTGGTGTGAAGTGG - Intronic
1000605882 5:163327101-163327123 TCCATGAGGGTGGGGTGAGGAGG - Intergenic
1005366622 6:25084527-25084549 TCCAGTTGGGTGGTGTGAGGGGG + Intergenic
1007069974 6:39029350-39029372 TCCCTGTGGCTGGAGTGCTCAGG - Intronic
1007121607 6:39386843-39386865 CCCATTTGGGGGATGTGATCAGG + Intronic
1007721191 6:43886314-43886336 CCCACGTGGGTGCTGTGACCTGG + Intergenic
1021946050 7:25728388-25728410 ACCATGTGCCTGGAGTGATCAGG - Intergenic
1023826313 7:44012288-44012310 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1026089888 7:67291153-67291175 TCCATGCCCATGGTGTGATCTGG + Intergenic
1026724405 7:72859351-72859373 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1026746565 7:73017708-73017730 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1026750217 7:73045851-73045873 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1026753864 7:73073961-73073983 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1026757515 7:73101997-73102019 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1027032668 7:74902266-74902288 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1027089889 7:75291489-75291511 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1027093534 7:75319417-75319439 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1027097177 7:75347384-75347406 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1027119481 7:75506472-75506494 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1027272344 7:76529139-76529161 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1027322171 7:77020286-77020308 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1027325803 7:77048205-77048227 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1029398286 7:100324385-100324407 TCCATGCCCGTGGTGTGATCTGG + Intergenic
1029718014 7:102343560-102343582 TCCATGCCCGTGGTGTGATCTGG - Intergenic
1029754600 7:102565685-102565707 TCCATGCCCGTGGTGTGATCTGG + Intronic
1029772551 7:102664769-102664791 TCCATGCCCGTGGTGTGATCTGG + Intronic
1031611527 7:123833214-123833236 TCCATGTGGGTGTAGTGAACGGG - Intronic
1042386601 8:68182985-68183007 TGCATGTGGATGGTGTGTTGGGG + Intronic
1042612907 8:70617609-70617631 TCCATGTGGATGGTGAACTCAGG + Intronic
1044434604 8:92147377-92147399 TCCATGAGGAGGGTGTGATTAGG - Intergenic
1048716236 8:137273516-137273538 TCCCTTTGGATGGTGTGGTCCGG + Intergenic
1048739602 8:137539922-137539944 TCAATGTTGGTGGGGTGACCTGG + Intergenic
1049992115 9:1000158-1000180 TCGAGGTGGGTGGTGGCATCTGG + Intergenic
1051126512 9:13811442-13811464 GCCATGTGGCTGGTGTCATCAGG - Intergenic
1052360962 9:27556726-27556748 TCTATGTGTGTGGTGGGATATGG + Exonic
1052832780 9:33229448-33229470 TCCCTGTGGTGGGTGTGATCTGG - Intronic
1057262258 9:93591675-93591697 TCCATGTGGGTGGGGTGTCCTGG + Intronic
1057941966 9:99292906-99292928 TCCCAGTGTGTGGTGGGATCGGG - Intergenic
1060204748 9:121675844-121675866 TCCAGGTGGGTGGTGCGAAGGGG + Intronic
1186873737 X:13797231-13797253 TCCTTGTGGGTGGGGTGAGGGGG + Intronic
1193066509 X:77265658-77265680 TACATGTTGGTGGAGGGATCTGG + Intergenic
1199900975 X:152171848-152171870 TTCATGTGGGTTTTGTGATGAGG + Intronic
1200396469 X:155992174-155992196 TCCAGGTGGGTGGTGGAATGGGG + Intergenic