ID: 918375010

View in Genome Browser
Species Human (GRCh38)
Location 1:183900262-183900284
Sequence CGGGCCTGCAGCCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918375009_918375010 -5 Left 918375009 1:183900244-183900266 CCATGTGGGTGGTGTGATCGGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234
918375002_918375010 22 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234
918375003_918375010 21 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375010 Original CRISPR CGGGCCTGCAGCCTTCCCAC TGG Intronic
900097128 1:944391-944413 GGGGCCTGCAGGCCTCCCCCTGG + Exonic
900134645 1:1110645-1110667 CTGGGATGCAGCCTTCCCCCCGG + Intronic
900157733 1:1210250-1210272 CAGCCCTGCAGGCTTCCCGCAGG - Intergenic
900421766 1:2558834-2558856 CGGGCCTGCTGCTTCCCCACAGG + Intronic
900549019 1:3244417-3244439 GTGGCCTGAAGCTTTCCCACAGG - Intronic
900759426 1:4460991-4461013 GGGGCCTACCGCCTTGCCACGGG + Intergenic
902376083 1:16030459-16030481 AGGGGCTGCAGCCTTCTCAGGGG + Exonic
902381013 1:16052196-16052218 AGGGGCTGCAGCCTTCTCAGGGG + Exonic
904893977 1:33800308-33800330 CAGGTCTTCAGCCTTCCTACTGG - Intronic
907334734 1:53692771-53692793 CGGGCCTGCTTTCTCCCCACTGG + Intronic
908044737 1:60156563-60156585 GAGGCCTCCATCCTTCCCACTGG + Intergenic
909490240 1:76218303-76218325 CAGTCCTGCAGCCTTTCCAGAGG + Intronic
911129472 1:94374268-94374290 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
911845441 1:102746486-102746508 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
913382920 1:118230079-118230101 CTAGCCTTAAGCCTTCCCACAGG + Intergenic
913960314 1:143334037-143334059 TGGGCCCGCAGCCCTCACACCGG + Intergenic
914054670 1:144159610-144159632 TGGGCCCGCAGCCCTCACACCGG + Intergenic
914124476 1:144806751-144806773 TGGGCCCGCAGCCCTCACACCGG - Intergenic
916083981 1:161254923-161254945 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
916785298 1:168082728-168082750 CAGGCCTGCAGCCTTCCTGATGG - Exonic
917676432 1:177323115-177323137 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG + Intronic
919559013 1:199095075-199095097 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
919741155 1:200982477-200982499 CCAGCCTCCAGCCATCCCACAGG + Intronic
923541514 1:234891372-234891394 CTGGCCTGACACCTTCCCACAGG + Intergenic
924711547 1:246533700-246533722 CCTGCCCTCAGCCTTCCCACAGG + Intergenic
1063414993 10:5865843-5865865 CCAGCCTTAAGCCTTCCCACAGG + Intronic
1069664669 10:70146437-70146459 CGGGCCTGGTGCTTTGCCACGGG - Exonic
1069960218 10:72075051-72075073 GGTGCCTGCAGCCTCCCCAGAGG - Intronic
1071999924 10:91185204-91185226 CAGGCCTCCAGCCACCCCACTGG - Intronic
1074753680 10:116609549-116609571 CGGGCCTGCCGCGATCCCTCGGG - Intergenic
1075146642 10:119888024-119888046 CCAGCCTTAAGCCTTCCCACAGG + Intronic
1075624030 10:123948733-123948755 TAGGCCTGCACCATTCCCACAGG - Intergenic
1076792463 10:132784672-132784694 GGGGCCCGCAGCCTCCGCACCGG + Intergenic
1079106038 11:17573092-17573114 CAGGCCTGCAGCGTGCTCACGGG + Exonic
1079126358 11:17720850-17720872 CGGGCCTCGAGCCGTCCCGCGGG + Intronic
1080545286 11:33310998-33311020 AGAGCCTGCAGCCATCCCACTGG - Intronic
1081146182 11:39564247-39564269 CCAGCCTTAAGCCTTCCCACGGG + Intergenic
1081991252 11:47338783-47338805 CGTGGATGCAGTCTTCCCACAGG - Intronic
1083026930 11:59559064-59559086 AGGGCCTTCACCCTGCCCACAGG - Intergenic
1083618646 11:64038283-64038305 TGGGCCTGCAGCCTCCCCTCTGG + Intronic
1084272813 11:68038266-68038288 CAGGCCTGGGGCATTCCCACTGG - Intergenic
1085477940 11:76799388-76799410 CGGGCCGGGAGCCTCCGCACGGG - Intergenic
1086053869 11:82625875-82625897 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1089459710 11:118645447-118645469 CGGGGCAGCACCCTTCCCAGCGG + Exonic
1090362796 11:126185316-126185338 CAGGCCTGCACCCCTCCCCCAGG + Intergenic
1096192647 12:49630577-49630599 AGCGCCTGCCCCCTTCCCACCGG + Exonic
1100210120 12:92391139-92391161 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1101365187 12:104064424-104064446 CGGGCCTCCAGCCTGGCCGCCGG + Intergenic
1102518340 12:113464654-113464676 CGGTCCTCCAGCCTTGCCCCGGG + Intronic
1103748478 12:123142557-123142579 GAGGCCTGCAGCCTTCCCCATGG - Intronic
1105277960 13:18947212-18947234 CAGGCCTCCAGCCTTCCCTGTGG - Intergenic
1107444366 13:40457224-40457246 CCGGGCTGCAGCCCTCCCAGTGG + Intergenic
1108023662 13:46155752-46155774 GGGGACTGCATCCTACCCACGGG - Intronic
1109424765 13:62154794-62154816 CCAGCCTTCAGCCTTCCCACAGG + Intergenic
1112407732 13:99136046-99136068 CTGGTCAGCAGCCTTTCCACTGG - Intergenic
1113541084 13:111110251-111110273 CATGCCTGCAGCCTTCCCCTGGG - Intergenic
1113569422 13:111343281-111343303 CAGCCCTGCAGCCTCCCCACAGG - Intronic
1115397001 14:32919770-32919792 CAGCCCTGCAGGCTTCCCAAGGG - Intergenic
1117422140 14:55557355-55557377 CTGGCATGCAGCCAGCCCACTGG + Intergenic
1118992613 14:70809629-70809651 CGCGCCCGCTGCCTTCCCATTGG + Intergenic
1119661771 14:76457209-76457231 AGTGCCTGCCTCCTTCCCACAGG + Intronic
1121283001 14:92712914-92712936 CGGGCCTCCAGCCATGCTACTGG + Intronic
1126071098 15:44865352-44865374 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
1131899569 15:97072748-97072770 CGGGCCTGCAGGCTTCAGACAGG + Intergenic
1132764737 16:1528706-1528728 CAGCCCTGCAGCCTCCCCGCTGG + Intronic
1133281843 16:4671141-4671163 GGGGCCTGAAGCCAACCCACAGG - Intronic
1136777627 16:32880159-32880181 AGAGCCTGCACCTTTCCCACAGG - Intergenic
1136892997 16:33981355-33981377 AGAGCCTGCACCTTTCCCACAGG + Intergenic
1137614460 16:49838596-49838618 CGGGCCCGCAGCCCACCCAAGGG + Intronic
1138300009 16:55918208-55918230 TGGGCCTGCAGCCATGCCTCTGG - Intronic
1139085295 16:63577455-63577477 CGGGCATAAAGTCTTCCCACAGG + Intergenic
1141347650 16:83262001-83262023 CAGACGTGAAGCCTTCCCACAGG - Intronic
1142213893 16:88821612-88821634 CGGGGCAGCCGCCTTCCCACGGG - Intronic
1203080042 16_KI270728v1_random:1142268-1142290 AGAGCCTGCACCTTTCCCACAGG - Intergenic
1142504980 17:357651-357673 CGTGCCAGCTGCCCTCCCACTGG - Intronic
1142534209 17:602578-602600 CCTGCCTGCAGCCTTCCCACTGG - Intronic
1142716282 17:1748672-1748694 CGGGCCTGCATCATTTCCACGGG - Exonic
1143814356 17:9499794-9499816 CAGGCCAGCAGGCTTCCCAAGGG + Intronic
1144891111 17:18494828-18494850 CAGGCCTGATGGCTTCCCACTGG + Exonic
1145241463 17:21243006-21243028 CCAGCCTGCATCCTGCCCACCGG - Exonic
1145794814 17:27649443-27649465 CAGGCCTGATGGCTTCCCACTGG + Exonic
1145804426 17:27716320-27716342 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1147360653 17:39927563-39927585 CGCGGCTGCAGCCTCCCCGCTGG + Intronic
1147505182 17:41009034-41009056 CGCTCCTGCAGCGTCCCCACCGG - Exonic
1151585109 17:75004082-75004104 CCGGCCTGCAGCCTCCCCCAGGG + Exonic
1151908994 17:77069072-77069094 GGGGACAGCAGCCTTCCCTCTGG - Intergenic
1152451505 17:80384167-80384189 CTGGCCTCCAGCTTCCCCACAGG - Intronic
1152626032 17:81388393-81388415 AGGGCCTGCAGCCTCCCCATGGG + Intergenic
1152762589 17:82116827-82116849 CAGGCTTGCAGCCCTCCCTCTGG + Intronic
1155475803 18:26235116-26235138 CCAGCCTTAAGCCTTCCCACAGG - Intronic
1155922187 18:31614405-31614427 CGGGCCTGGAGGCTTCACAGAGG + Intergenic
1159274097 18:66193406-66193428 TGAGCCTGGAGCCTTCCCACAGG - Intergenic
1160509100 18:79443490-79443512 GGGGCCTGGAGCCGTCCCTCGGG + Intronic
1160905424 19:1449736-1449758 CAGGCCTGCACCCACCCCACAGG - Intronic
1161589040 19:5120501-5120523 GGGGGCAGCCGCCTTCCCACAGG + Intronic
1161597898 19:5161383-5161405 CCAGCCTTAAGCCTTCCCACAGG - Intronic
1162949256 19:14061123-14061145 CGGGACTTCAGCCCTCCCCCAGG - Intergenic
1163202291 19:15777868-15777890 CTGGGCTGCTGCTTTCCCACAGG - Intergenic
1163561599 19:18022525-18022547 CCAGCCTTCAGCCTTCCCTCTGG - Intergenic
1163632033 19:18422385-18422407 GGGCCCTGCAGCCTCCCCACTGG - Intronic
1163821309 19:19498042-19498064 CTGGCCTACTGCCTTCTCACAGG - Intronic
1164711566 19:30360508-30360530 AGGGCTTGCACCTTTCCCACAGG + Intronic
1164992768 19:32696488-32696510 CTAGCCTTAAGCCTTCCCACAGG - Intronic
1165849235 19:38839729-38839751 CGGGCCTTCTGCCTTCCCATGGG - Intronic
1166416290 19:42596626-42596648 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166433022 19:42742176-42742198 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166436123 19:42767402-42767424 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166453383 19:42919582-42919604 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166455869 19:42938891-42938913 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166465664 19:43028166-43028188 CCGGCCTGGAGTCTTCCCAAGGG - Intronic
1166471802 19:43084370-43084392 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166482936 19:43188186-43188208 CCAGCCTGGAGCCTTCCCAGGGG - Intronic
1166492570 19:43271238-43271260 CCAGCCTGGAGCCTTCCCAGGGG - Intergenic
1167529766 19:50008004-50008026 CGGACCTGCATCCTTCCCTCAGG + Intronic
1202694151 1_KI270712v1_random:112288-112310 TGGGCCCGCAGCCCTCACACCGG + Intergenic
927208796 2:20626313-20626335 CTGTCCTGCAGCCTTCCAGCAGG - Intronic
927673727 2:25089785-25089807 TGGGCATGCAGCCCGCCCACTGG + Intronic
928378821 2:30801141-30801163 CGGGCCTGCTCACTTCCCAAAGG + Intronic
928393617 2:30927803-30927825 AAGGCCTGCAGTCTGCCCACTGG - Intronic
929243460 2:39676500-39676522 GCGTCCTGCAGACTTCCCACCGG + Intronic
930105107 2:47633152-47633174 CGGGCCTTCAGCCTTGCCCAGGG + Intergenic
930108647 2:47659156-47659178 GGGCCCTGGAGCCTTCCCTCGGG - Intergenic
930691376 2:54369090-54369112 GGAGCCTGCAGCCATCACACTGG + Intronic
931464707 2:62476051-62476073 CCAGCAAGCAGCCTTCCCACTGG + Intergenic
934559424 2:95304967-95304989 GGGACCTGCAGCCTTCTCAAAGG - Intronic
940140301 2:150485765-150485787 GGGGCCGGATGCCTTCCCACCGG + Intronic
945213874 2:207412862-207412884 AAAGACTGCAGCCTTCCCACAGG + Intergenic
947643415 2:231720664-231720686 AGGGGCTGCTGGCTTCCCACAGG - Intergenic
1169661354 20:7981915-7981937 AGGGCCTGCAGCCTTGTCTCTGG + Exonic
1170436687 20:16337839-16337861 GGGCCCTGCTGCCTTCCAACAGG + Intronic
1172133583 20:32672821-32672843 TGGCCCTGCTGTCTTCCCACAGG + Intergenic
1172196823 20:33097595-33097617 CTGGCCTGGTGCCTGCCCACAGG + Exonic
1173838344 20:46140086-46140108 TGGGCCTGCAGCCTTCTGAGTGG - Intergenic
1174819814 20:53716706-53716728 CAGACCTACAGCGTTCCCACGGG - Intergenic
1175516777 20:59575199-59575221 CGGCCCTGCCGCCTGTCCACGGG - Intergenic
1176117571 20:63439754-63439776 CGGGCGTCCAGCCTGCCCTCAGG - Intronic
1176363193 21:6015995-6016017 GGGGCCTGCCACCTGCCCACCGG + Intergenic
1177135371 21:17301299-17301321 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1178109699 21:29357780-29357802 CCAGCCTTAAGCCTTCCCACAGG - Intronic
1178239469 21:30882176-30882198 CTGCCCTCTAGCCTTCCCACGGG - Intergenic
1179613843 21:42569236-42569258 TGGTGCTGGAGCCTTCCCACTGG + Intronic
1179760325 21:43522550-43522572 GGGGCCTGCCACCTGCCCACCGG - Intergenic
1180606772 22:17064905-17064927 TGGGCTTGCAGGCTTCCCTCTGG - Intergenic
1180800460 22:18629504-18629526 GGAGCCTGGAGTCTTCCCACTGG + Intergenic
1180871917 22:19151001-19151023 CTGTCCTCCAGCTTTCCCACTGG + Intergenic
1181221259 22:21365758-21365780 GGAGCCTGGAGTCTTCCCACTGG - Intergenic
1183082484 22:35465363-35465385 AGGGCCTGCAGCTTTCACAGGGG + Intergenic
1183323171 22:37177387-37177409 CCGGCCTGCTGGCTTCCCACTGG + Intergenic
1183708429 22:39488899-39488921 CGGGCGGGCGGCCTTCCCTCGGG - Exonic
1183985461 22:41567684-41567706 CAGGACTCCTGCCTTCCCACTGG + Intronic
1184184963 22:42858169-42858191 CGGGGCTGCACCCTACCCTCTGG + Intronic
1184785252 22:46668468-46668490 CGGGCCTGAGTCCTTCCCAGGGG - Intronic
1185332971 22:50259973-50259995 CAGGACTGCAGCCTTCCCCACGG - Intronic
952940642 3:38441909-38441931 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
953622629 3:44546401-44546423 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
953780269 3:45862796-45862818 ATGGCTTGCAGCCTTCCCTCAGG + Intronic
954232084 3:49225488-49225510 CCAGCCTTAAGCCTTCCCACAGG - Intronic
954599094 3:51853757-51853779 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
954636339 3:52072900-52072922 GGGGCCTGCAGCATCTCCACGGG + Intergenic
955405407 3:58622745-58622767 CTGCCCAGCAGCCTCCCCACTGG - Intronic
961411015 3:126720397-126720419 GGGGCCTGGTGCATTCCCACAGG + Intronic
961665542 3:128491531-128491553 CAGGCCAGCAGCCATCCCTCCGG + Intronic
963802456 3:149689544-149689566 CCGGCCTGCAAGGTTCCCACTGG - Intronic
967975025 3:195029401-195029423 GGGGCTGGCAGGCTTCCCACAGG + Intergenic
968586064 4:1416565-1416587 CGGGCCAGCTGCCTTCGCACTGG + Intergenic
968603072 4:1519537-1519559 CAGGCAGGCAGCCTTCCCGCTGG + Intergenic
968816370 4:2823824-2823846 CCGGCCTGCACCCTGGCCACAGG + Intronic
969299832 4:6291400-6291422 CTGGGCGCCAGCCTTCCCACAGG + Intronic
969424183 4:7114396-7114418 CTGACCCGCAGCCTTCCCACGGG - Intergenic
969445911 4:7244635-7244657 TGGGCCTTCAGTCTTCCCAGGGG - Intronic
972132983 4:35860628-35860650 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
972786042 4:42327603-42327625 CATGCCCGCAGCCTTCCCAGAGG + Intergenic
974081381 4:57216896-57216918 TGGGCATACAGGCTTCCCACAGG - Intergenic
975139143 4:70902509-70902531 CGAGCCTGCAGCCTGCCCCGCGG + Exonic
976225191 4:82790267-82790289 GCTCCCTGCAGCCTTCCCACTGG - Intronic
978777184 4:112515940-112515962 CGGGCTTGCAGCTTTCACGCCGG - Exonic
983084438 4:163426361-163426383 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
985630384 5:1010866-1010888 CTGGCCTGGAGCCTTCTCCCTGG + Intronic
985671564 5:1209449-1209471 CAGGCCTGCAGGCTTCCGAAGGG - Intronic
986663048 5:10076167-10076189 CCTGCCTGCAGCCATTCCACTGG + Intergenic
986694526 5:10339934-10339956 CAGGCCAGCAGCCTTCACTCAGG - Intergenic
986933468 5:12854988-12855010 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
987964194 5:24851011-24851033 CAGAACTCCAGCCTTCCCACAGG + Intergenic
990367700 5:55087585-55087607 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
991303747 5:65154344-65154366 CTGGCCTCCAGCCTGCCCACAGG - Intronic
992049672 5:72930839-72930861 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
992545924 5:77813618-77813640 CCAGCCTTAAGCCTTCCCACAGG + Intronic
996099064 5:119429252-119429274 CTAGCCTTAAGCCTTCCCACAGG - Intergenic
997280240 5:132638432-132638454 AGGGCCTGAAGCATTCTCACAGG + Intronic
997673841 5:135697729-135697751 CGTGCCAGCAGCCTTCTCCCAGG + Intergenic
998915227 5:147004748-147004770 CCAGCCTTAAGCCTTCCCACAGG + Intronic
999245764 5:150153835-150153857 CAGGCCTCCAGCCTTCTCACAGG - Intronic
999443491 5:151620756-151620778 TGGGACAGCAGCCTTCCCTCTGG + Intergenic
1001237983 5:170045915-170045937 AGGGCATTCAGCCTTCCCAGGGG - Intronic
1002763327 6:218390-218412 AGGGCCTGCAGCCAGCCCGCTGG + Intergenic
1002820678 6:721651-721673 CGGGAATGAAGCCTTCCAACTGG + Intergenic
1003377746 6:5594956-5594978 CCGGCCGGCAGCCTTCCTCCAGG + Intronic
1004476601 6:15979227-15979249 TGGTTCTGCAGCCTTCCCACTGG - Intergenic
1004492419 6:16129253-16129275 CGGGGCTGCCGCCTTGTCACTGG - Exonic
1005784794 6:29232743-29232765 CAGGCCTGCAGCCTTCCAACAGG + Intergenic
1005987522 6:30884107-30884129 CGGGACTGCAGCCAGCCCCCTGG + Intronic
1006166690 6:32069623-32069645 CGGGCCTGGACCCTGCCCACAGG - Intronic
1006640190 6:35485748-35485770 CGGACCTGATCCCTTCCCACAGG + Intronic
1006982093 6:38154966-38154988 AGGGCATGCTGCCTTCCCTCAGG - Intergenic
1007030328 6:38620942-38620964 CTAGCCTTAAGCCTTCCCACAGG + Intronic
1007730203 6:43940935-43940957 CAGGCCTGCAGCCCTGCCCCTGG + Intergenic
1008848177 6:55993544-55993566 TGGGGCTGGAGCCTTCACACAGG - Intergenic
1010075112 6:71789160-71789182 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1013087918 6:106872222-106872244 GGGGCCTACAGCCTACCCAAGGG - Intergenic
1013714045 6:112936221-112936243 CGGCCCTGTAGCCATCCCTCAGG - Intergenic
1014986483 6:128017442-128017464 TAGGCCTGCAGGGTTCCCACAGG - Intronic
1017126383 6:151068287-151068309 CGGGCCTGAAGCCTTTCGTCTGG + Intronic
1017224727 6:152007699-152007721 TGGGCCTGTGGCCTTCACACAGG - Intronic
1017638547 6:156467324-156467346 TGGGGCTGCAGCCCTCCCATCGG - Intergenic
1019038030 6:169078492-169078514 GGGGCCTGCCACCATCCCACGGG + Intergenic
1019306905 7:339928-339950 GGGGCCTGCCATCTTCCCACAGG + Intergenic
1019368866 7:650431-650453 CAGCCCTCCAGCCTTCACACCGG + Intronic
1019574177 7:1728284-1728306 CCGGCCTGCACCCTTCCCAGAGG + Intronic
1023052399 7:36264469-36264491 AGGGCCTGCAGCATTGGCACAGG + Intronic
1024598908 7:50962579-50962601 CGGGCGTCCAGCCCTCCCATGGG - Intergenic
1029641959 7:101826649-101826671 CCTTCCTGCAGCCTTCCCAGAGG - Intronic
1038728794 8:30107611-30107633 TGTGGCTGGAGCCTTCCCACTGG + Intronic
1040384899 8:46908016-46908038 CAGGCCTGCCTCCTTCCCTCTGG - Intergenic
1041024519 8:53670196-53670218 CAGGACAGCACCCTTCCCACGGG - Intergenic
1044005154 8:86929976-86929998 CCAGCCTTAAGCCTTCCCACAGG - Intronic
1047327732 8:123855588-123855610 TGGGCCGGCTGTCTTCCCACTGG + Intronic
1049217144 8:141413389-141413411 CGGTCCTGCTGCCTTCCTCCTGG - Intronic
1055458131 9:76492151-76492173 CCAGCCTTAAGCCTTCCCACAGG - Intronic
1057470037 9:95349350-95349372 CGTTCCTCCAGCCTTCCCGCTGG + Intergenic
1057599736 9:96447576-96447598 AGGGCCTGTCGTCTTCCCACTGG - Intergenic
1057751303 9:97795588-97795610 TGAGCCTGCAGCCTTCAGACTGG - Intergenic
1058045350 9:100352387-100352409 CGGTCCTGCATCCATCCCAGAGG + Intronic
1059145480 9:111896390-111896412 CGCGTCTGCAGCCTCCCCGCCGG - Intergenic
1059416915 9:114168094-114168116 CTGTCCTGCTGCCTTTCCACAGG + Exonic
1060215711 9:121737184-121737206 CTGGCCTGCACCCTGCCCAGAGG + Intronic
1060239143 9:121888041-121888063 CTGGCCTGCAGCCTTGGCCCAGG + Intronic
1060547105 9:124468199-124468221 CGGGCTTCCAGCCCACCCACTGG - Intronic
1061049060 9:128183413-128183435 CCCGCCTCCAGCCTTCCAACGGG - Intronic
1061472044 9:130834994-130835016 CAGGCCTGCACCCTCCCCGCCGG + Intronic
1061806559 9:133140491-133140513 AGGTCCTGCACCCTTCCCATGGG + Intronic
1062002950 9:134226003-134226025 CGGCCTGGCAGCCCTCCCACAGG - Intergenic
1062023280 9:134329136-134329158 CGGGCCTACAGCTTTGCCACCGG - Intronic
1062352261 9:136144981-136145003 GGAGCCTGCATCTTTCCCACAGG - Intergenic
1186672079 X:11778068-11778090 CTTGCCTTCAGCCTTCCCTCCGG + Intergenic
1188097810 X:26044658-26044680 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1188136797 X:26502007-26502029 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1191252036 X:58264353-58264375 CTGGCCTGCACCTGTCCCACGGG + Intergenic
1194843059 X:98768751-98768773 AAGACCTGCAGCCTTCCAACAGG + Intergenic
1195703697 X:107723568-107723590 GTGTCCTGCAGCCTTCCCAGGGG + Intronic
1195850875 X:109280400-109280422 CCAGCCTTAAGCCTTCCCACGGG - Intergenic
1195923265 X:110002908-110002930 CCGGCCTCCCGCCTTCCCTCTGG + Intronic
1196127080 X:112112254-112112276 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
1199746760 X:150776567-150776589 ACGCCCTGCAGGCTTCCCACTGG + Intronic
1200102219 X:153693883-153693905 AGAGCCTGCACCTTTCCCACAGG + Exonic
1200711415 Y:6487901-6487923 CCAGCCTTAAGCCTTCCCACAGG + Intergenic
1200822862 Y:7605979-7606001 CGTCCCTACATCCTTCCCACTGG - Intergenic
1201022519 Y:9674086-9674108 CCAGCCTTAAGCCTTCCCACAGG - Intergenic
1202237193 Y:22725110-22725132 CGTCCCTACATCCTTCCCACTGG + Intergenic