ID: 918375010

View in Genome Browser
Species Human (GRCh38)
Location 1:183900262-183900284
Sequence CGGGCCTGCAGCCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918375009_918375010 -5 Left 918375009 1:183900244-183900266 CCATGTGGGTGGTGTGATCGGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234
918375003_918375010 21 Left 918375003 1:183900218-183900240 CCTTCAGGACTACATCGAGGTGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234
918375002_918375010 22 Left 918375002 1:183900217-183900239 CCCTTCAGGACTACATCGAGGTG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918375010 1:183900262-183900284 CGGGCCTGCAGCCTTCCCACTGG 0: 1
1: 0
2: 2
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918375010 Original CRISPR CGGGCCTGCAGCCTTCCCAC TGG Intronic