ID: 918376192

View in Genome Browser
Species Human (GRCh38)
Location 1:183911547-183911569
Sequence CTACAGGCCTTAAGTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2442
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 2409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918376192 Original CRISPR CTACAGGCCTTAAGTGAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr