ID: 918376324

View in Genome Browser
Species Human (GRCh38)
Location 1:183912807-183912829
Sequence TGTCCGTCTTAGCATGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 36}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918376324 Original CRISPR TGTCCGTCTTAGCATGCTAA GGG (reversed) Intronic
912395911 1:109343893-109343915 TGCTCGTCTTAGCCTCCTAAAGG + Intronic
917318745 1:173757365-173757387 TGTCTGTAGTAGCATGCTTAGGG - Intronic
917897535 1:179506279-179506301 TGTCAGTCTTGGCCTGCTGAAGG - Intronic
918358909 1:183734810-183734832 TATCTCTCTTAGAATGCTAAAGG + Intronic
918376324 1:183912807-183912829 TGTCCGTCTTAGCATGCTAAGGG - Intronic
1065432106 10:25669785-25669807 TGTATATCTTAACATGCTAACGG - Intergenic
1074524916 10:114254793-114254815 TGTCCCTCTTAGCATGAAAGGGG - Intronic
1075497761 10:122941723-122941745 TGTCCTTTTAAACATGCTAATGG - Intronic
1079619444 11:22535336-22535358 TGTATGTGTTAGCTTGCTAACGG + Intergenic
1079622575 11:22572110-22572132 TGTCCTTCTTAGGATGCTACTGG - Intergenic
1083002955 11:59313541-59313563 TGGCCATCTTTGCATGCCAAGGG - Intergenic
1094198241 12:27771534-27771556 TGCACGTCTTAAGATGCTAAGGG - Intergenic
1100662816 12:96718501-96718523 GATCACTCTTAGCATGCTAAAGG + Exonic
1101763288 12:107676770-107676792 TTTCCATCTTAGCATGCCCAGGG - Intergenic
1106800950 13:33255329-33255351 AGTCCCTCTCAGCATCCTAAAGG - Intronic
1107285402 13:38784723-38784745 TGTCCTTCTGAGCATGCCCATGG + Exonic
1124369858 15:29098478-29098500 TGTCCTTCTTAGAATTCTGAGGG + Exonic
1129048186 15:72755754-72755776 TGGCCTTCTTTGCATGCTCACGG + Intronic
1142335185 16:89484543-89484565 TTTCAGACTTAGGATGCTAATGG - Intronic
933228906 2:79783115-79783137 TGTCCCTCTGTGCATGCTGATGG + Intronic
941164728 2:162073327-162073349 GCTCCGTCTTACCACGCTAAGGG - Intronic
946680363 2:222208356-222208378 AGTCCCTCTTAATATGCTAAGGG - Intronic
946900664 2:224368506-224368528 CTTCCTTCTTAGCCTGCTAAAGG + Intergenic
1179231639 21:39509161-39509183 TTTCCTTCTCAGCATGTTAAAGG - Intronic
964935138 3:162075321-162075343 TGTCCGTGTTACAATGATAAGGG - Intergenic
966752405 3:183334858-183334880 TGTCCGCCTTAGCCTCCCAAAGG - Intronic
974965545 4:68756513-68756535 TGCATGTCTTAGCATGCTCAGGG + Intergenic
974970123 4:68812861-68812883 TGCATGTCTTAGCATGCTCAGGG - Intergenic
975005448 4:69277465-69277487 TGCATGTCTTAGCATGCTCAGGG - Intergenic
975015126 4:69405801-69405823 TGCATGTCTTAGCATGCTCAGGG - Intronic
976865965 4:89727457-89727479 TGTATGTCTGAGCATGCAAATGG - Intronic
997617310 5:135256951-135256973 TGTCAGTTTCAGCATGCTACCGG + Intronic
1006575946 6:35046086-35046108 TGTGCTGCTTATCATGCTAAAGG + Intronic
1021654784 7:22864325-22864347 TGTCTTTCTTAGCATGAGAATGG + Intergenic
1029586857 7:101478459-101478481 TGTCCCTCTCACCATTCTAATGG + Intronic
1035359866 7:158304389-158304411 TGTACGTCTTAGCATATTGACGG - Intronic
1044755826 8:95460299-95460321 TGTCACTGTTAGCATGCCAAAGG - Intergenic
1052055969 9:23907915-23907937 TGTCCTTCTTAGCATATTAATGG - Intergenic
1059389024 9:113987224-113987246 TGTCCATGTTATCATCCTAAGGG - Intronic
1186569706 X:10701368-10701390 TGTCCTTCTAAGCATGCTAAAGG - Intronic