ID: 918378543

View in Genome Browser
Species Human (GRCh38)
Location 1:183932834-183932856
Sequence CCCATGAGTCCCCACCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918378536_918378543 25 Left 918378536 1:183932786-183932808 CCTCTCAGGGCCTGAGAGATCGG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 282
918378541_918378543 -1 Left 918378541 1:183932812-183932834 CCACACAGAGCTGGCAGCGATTC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 282
918378538_918378543 15 Left 918378538 1:183932796-183932818 CCTGAGAGATCGGCCACCACACA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 282
918378540_918378543 2 Left 918378540 1:183932809-183932831 CCACCACACAGAGCTGGCAGCGA 0: 1
1: 0
2: 0
3: 12
4: 205
Right 918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 282
918378535_918378543 26 Left 918378535 1:183932785-183932807 CCCTCTCAGGGCCTGAGAGATCG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918378543 Original CRISPR CCCATGAGTCCCCACCTCCT TGG Intronic
900409882 1:2507739-2507761 TCCATGCCACCCCACCTCCTTGG + Intergenic
900645964 1:3708870-3708892 CCCACGAGGCCCCGCCTCCCCGG + Intronic
901859117 1:12063141-12063163 CCTGTGAGTCCCCACCTCCAGGG + Intergenic
903192665 1:21665743-21665765 CCCTTGGGTACCCTCCTCCTGGG + Intronic
903478839 1:23638534-23638556 CCCATCAGTCCCCTCCTTCTGGG - Intronic
903509638 1:23865529-23865551 CCGATGAGGCCCCACGTCTTTGG + Exonic
904721833 1:32516018-32516040 CCCAGGAGCCTCCACCTCATGGG - Intronic
904721880 1:32516419-32516441 CCCAGGGGTCCCCAACCCCTGGG + Intronic
906118963 1:43374801-43374823 CCCAAGGGTCCCCAACCCCTGGG - Intergenic
906837785 1:49102434-49102456 CTCAGGAGTCCCCACGTGCTGGG - Intronic
908234086 1:62133820-62133842 CCACTGAGCCTCCACCTCCTGGG + Intronic
910790082 1:91041936-91041958 CACTTCAATCCCCACCTCCTGGG - Intergenic
911573040 1:99540662-99540684 ACCAGGAGTCCCCAACTCCTGGG - Intergenic
912506730 1:110161705-110161727 TCCCTGAGCACCCACCTCCTGGG - Intronic
912969312 1:114265663-114265685 TCCATGAGTCCCCCCTTCATAGG - Intergenic
915893900 1:159796179-159796201 CCCATGAGTGTCCAACTCCCAGG + Intergenic
916762892 1:167832986-167833008 CCCAAGAGAGCCCACCTCCAGGG - Exonic
917528865 1:175815047-175815069 CCCAGGAGGCCCCACCTTCCTGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
919902669 1:202055790-202055812 CCCTGCAGTCTCCACCTCCTGGG + Intergenic
919939779 1:202278327-202278349 CCCATGACTCCCCTTCTTCTTGG - Intronic
920182084 1:204138258-204138280 CCCATGAGGCCCCTCTCCCTAGG + Intronic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
921285194 1:213603294-213603316 ACCATGTGACCTCACCTCCTGGG + Intergenic
922501345 1:226098974-226098996 CCCACCAGGCCCCACCTCATAGG - Intergenic
922846538 1:228689540-228689562 GCCAGGGGTCCCCAACTCCTGGG + Intergenic
924739300 1:246785648-246785670 CCCATGGATCCTCACCTCCTGGG + Intergenic
1066002135 10:31114608-31114630 GCAATGTGTCCCCACTTCCTGGG + Intergenic
1066043442 10:31576481-31576503 CCAGGGAGTCCCCACCTCCAAGG + Intergenic
1067857066 10:49803606-49803628 CACATCAGTCTCCACCTCCCAGG - Intergenic
1068762934 10:60733151-60733173 CCCAGGAGTCCTGCCCTCCTGGG - Intronic
1069273937 10:66566280-66566302 CCCATCAGTCACCAAATCCTGGG - Intronic
1069358491 10:67614745-67614767 CCCAGGGGTCCCCAACCCCTAGG - Intronic
1070615166 10:77963939-77963961 CTCAGGGGTCCCCAACTCCTGGG + Intergenic
1071649436 10:87380898-87380920 CCCATTTGTTCCCACCTCTTAGG + Intergenic
1072309208 10:94138373-94138395 CCCATAGGTCCCCAGTTCCTGGG - Intronic
1073404667 10:103286803-103286825 ACCATGAGTCCAAATCTCCTGGG + Intronic
1074686282 10:115965109-115965131 CCTATGACTCCCCAACCCCTGGG + Intergenic
1075275206 10:121086759-121086781 GCCATGACCCCCCACCACCTCGG + Intergenic
1076070440 10:127484321-127484343 CCCATCAGTCCCCATCCCCATGG + Intergenic
1077305385 11:1866602-1866624 CCCATAAGCCTCCTCCTCCTGGG + Exonic
1077439518 11:2561526-2561548 ACCAGCAGTGCCCACCTCCTAGG - Intronic
1077446000 11:2591223-2591245 CACCTGCATCCCCACCTCCTTGG + Intronic
1077818539 11:5712414-5712436 CCCTTCTGTCCCCATCTCCTGGG - Intronic
1077957855 11:7040210-7040232 CACAGGGGTCCCCAACTCCTGGG + Intronic
1078404695 11:11060179-11060201 TCCATGAGTCTCCATTTCCTGGG - Intergenic
1079283178 11:19106231-19106253 CCCAGGCCTCCCCATCTCCTGGG + Intergenic
1082103431 11:48193608-48193630 CCCCTCACTCCCCAGCTCCTTGG + Intergenic
1083203626 11:61134417-61134439 CCCATGCGTCTCCACCTCGTGGG - Intronic
1083282060 11:61633080-61633102 CCCAGGGGTCCCCAGCTCCCAGG + Intergenic
1083625683 11:64070906-64070928 CCCATGGGTCCACATCTTCTAGG + Intronic
1084118378 11:67055072-67055094 GCTAAGAGTCCCTACCTCCTAGG + Intergenic
1084543925 11:69804451-69804473 CCAATCATTCCCCACCTTCTGGG + Intergenic
1086993117 11:93327877-93327899 CCCAGGGGTCCCCAACCCCTGGG - Intergenic
1088952269 11:114583867-114583889 CCCATAAGTCCCCATCTCCTGGG - Intronic
1089159055 11:116423908-116423930 CCCGTGAGGACCCACCTCCTGGG - Intergenic
1089535716 11:119159860-119159882 CCCATGAGCTACCAACTCCTAGG - Intronic
1090043087 11:123307842-123307864 TCCTTGACTCCCCAGCTCCTTGG + Intergenic
1090902685 11:131046671-131046693 CCCTTGATTCCCGGCCTCCTCGG - Intergenic
1091273967 11:134337619-134337641 CCCATGAGGCTCAACTTCCTTGG - Intronic
1091390176 12:121495-121517 CCCAGGAATCCCCACATCATGGG + Intronic
1095368066 12:41431830-41431852 CCCATGTGTCATCCCCTCCTTGG - Intronic
1096172690 12:49485833-49485855 CCCTTTAGCCTCCACCTCCTGGG + Intronic
1096350067 12:50890497-50890519 CCCAGGAGTCTCAAACTCCTGGG - Intergenic
1096869042 12:54582028-54582050 CCCAGGAGTCCCGCCCACCTGGG - Exonic
1097645792 12:62234241-62234263 GCCATGGGTCCCCACAGCCTTGG + Intronic
1097788606 12:63789256-63789278 CCCATTTCTCCCCATCTCCTTGG - Intronic
1098754184 12:74337368-74337390 CCCATTGATCCTCACCTCCTTGG - Intergenic
1099058372 12:77873869-77873891 CCCAGGGGTCCCCAACCCCTGGG + Intronic
1101685730 12:107018345-107018367 TCCAGGAGTCTCCACCACCTTGG - Intronic
1102056145 12:109898006-109898028 CCCATTAATCCCTACCCCCTTGG - Intergenic
1104585905 12:130047793-130047815 GGTATGAGTCCCGACCTCCTAGG - Intergenic
1104683375 12:130767552-130767574 CCCAAGAGTGCCTACCCCCTGGG - Intergenic
1105296203 13:19089779-19089801 CCAATGAGGCCCCACTTCTTGGG + Intergenic
1106218255 13:27722107-27722129 CTCATGAGTACCCACAGCCTGGG + Intergenic
1107149136 13:37091557-37091579 CACAGTGGTCCCCACCTCCTGGG + Intergenic
1107743405 13:43479178-43479200 CCCTTTAGTCCCAACATCCTTGG - Intronic
1108053130 13:46464429-46464451 CCTCTGAGTCCCCGCCTCGTTGG - Intergenic
1108053161 13:46464508-46464530 CCTCTGAGTCCCCGCCTCGTGGG - Intergenic
1108380359 13:49848652-49848674 CCCATGTGGCCCCAGCTACTAGG + Intergenic
1113364774 13:109665888-109665910 ACCATGAGTCAGCACCTCCACGG + Intergenic
1113578967 13:111414555-111414577 CCCATGGGTCACCTCCTCATGGG - Intergenic
1114244546 14:20900464-20900486 CACTTTAGCCCCCACCTCCTGGG + Intergenic
1115479685 14:33849320-33849342 CCCAAGGGTTCCCACATCCTTGG - Intergenic
1116075095 14:40100960-40100982 CACAGCAGTCTCCACCTCCTGGG + Intergenic
1117157814 14:52958189-52958211 ACCAGGGGTCCCCAACTCCTGGG + Intergenic
1118762402 14:68888589-68888611 ACCAGGGGTCCCCACCCCCTGGG + Intronic
1118968296 14:70608939-70608961 CCCATTATTCCACACCTCCGTGG - Intergenic
1119012115 14:71004286-71004308 CCCAGGGGTCCCCAACTCCCAGG + Intronic
1119193804 14:72702386-72702408 CCCATGTCTCCCCTGCTCCTTGG + Intronic
1120910390 14:89661316-89661338 CCCAAGAGATCCCACCACCTTGG + Intergenic
1121270888 14:92637515-92637537 CCCAGGGGTCCCCAACCCCTGGG - Intronic
1121542946 14:94742059-94742081 CCCAAGTGTTCCCTCCTCCTGGG - Intergenic
1122649611 14:103219385-103219407 CACAAGAGCCCCAACCTCCTGGG + Intergenic
1123028419 14:105439399-105439421 CCCATGTGTCACCACCCCCCAGG - Intronic
1124347598 15:28932841-28932863 TCCATAAGGCCCCATCTCCTTGG - Intronic
1124832336 15:33161367-33161389 CCCCTGACTCCCTATCTCCTGGG + Intronic
1124876908 15:33603279-33603301 CCCATCCTTCTCCACCTCCTGGG - Exonic
1125499754 15:40232252-40232274 CCCAGGGGTCCCCAGCCCCTGGG - Intergenic
1125591867 15:40859284-40859306 CCCGAGAGCTCCCACCTCCTCGG - Intergenic
1125687509 15:41572361-41572383 TGCATAAGTCCCCACCTGCTGGG - Intronic
1127932237 15:63604537-63604559 TCCATCAGTGCCCACCTTCTGGG - Intergenic
1128617028 15:69118194-69118216 CTGATGAGTACCCCCCTCCTGGG - Intergenic
1128698779 15:69788836-69788858 CCCATGAATCCTCCCCACCTTGG - Intergenic
1128724078 15:69975054-69975076 ACAATGACTCCCCACCTTCTGGG + Intergenic
1129387475 15:75203683-75203705 CCCAGGAGTCCCTCTCTCCTGGG - Intronic
1129392691 15:75228481-75228503 CCCATCACTACCCACCTCCAAGG - Intergenic
1130081369 15:80736905-80736927 CCCATGAGACACCATCTCCTTGG + Intronic
1130905949 15:88241033-88241055 CCCAAGAGCCCCCACCTAGTAGG - Intronic
1130918905 15:88327627-88327649 AGCAGGAGTCCCCAACTCCTGGG - Intergenic
1131933606 15:97475500-97475522 TCCATAAGTCTCCACCCCCTAGG + Intergenic
1133790037 16:9002581-9002603 CCCATGTGGTCCCAGCTCCTTGG - Intergenic
1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG + Intergenic
1135375563 16:21944057-21944079 CCCATGAGCCCACACCACCAGGG - Intergenic
1135679284 16:24442996-24443018 ACCAGGGGTCCCCAACTCCTGGG - Intergenic
1136146404 16:28319148-28319170 CCCAGGAGTACGCACCTGCTGGG + Exonic
1136476831 16:30518715-30518737 CCCAGGTATCTCCACCTCCTTGG + Exonic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1136502272 16:30677906-30677928 CCCATCACTGCCCACCACCTTGG - Intergenic
1137589837 16:49686837-49686859 CCCATGCTTCCTCACCTCCCAGG + Intronic
1138117485 16:54372131-54372153 CTCATCAGACGCCACCTCCTCGG - Intergenic
1138245452 16:55463694-55463716 AGCATGTGTCCCCATCTCCTTGG - Intronic
1140201159 16:72895746-72895768 CCCTTCAGCCTCCACCTCCTGGG - Intronic
1141428204 16:83957114-83957136 GCAATGAGTCCCTACCTCCTAGG - Intronic
1142977884 17:3656237-3656259 CCCACCAGTCCTCACCCCCTGGG + Intronic
1143327799 17:6110838-6110860 CCCATGTGTTCCCGGCTCCTGGG - Exonic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1144417563 17:15066086-15066108 CCCATGAATCCTCAGCTACTTGG + Intergenic
1145254686 17:21316174-21316196 CCCATGGGGACCCTCCTCCTGGG - Intergenic
1145321911 17:21771791-21771813 CCCATGGGGACCCTCCTCCTGGG + Intergenic
1147914323 17:43877614-43877636 CCCATGAATGCCCACCTCCCTGG + Intronic
1150223310 17:63509253-63509275 CCCATCCCTGCCCACCTCCTGGG + Intronic
1150289099 17:63971481-63971503 CCCATGGGTCCTCACCTGCTGGG - Intronic
1151199121 17:72454752-72454774 CCCAGGGGTCCCTACCTCTTGGG + Intergenic
1151745454 17:76009422-76009444 CTCATGCCTCACCACCTCCTGGG + Exonic
1152380373 17:79939236-79939258 CCCATCAGTGCCCAGATCCTGGG - Exonic
1152572102 17:81125389-81125411 CCCATCAATTCCCACCTCCTGGG - Intronic
1152822148 17:82442832-82442854 CCCAGGAGTCCCCAGCTCACAGG + Exonic
1152891187 17:82882514-82882536 CCCATGAGTCCCCAGGGCATGGG - Intronic
1155738314 18:29252275-29252297 ACCATCATTCCTCACCTCCTAGG - Intergenic
1157273629 18:46294834-46294856 CCCCTCAGTCCCCACCACCAAGG - Intergenic
1157549056 18:48568351-48568373 CCAATGTTTCCCCACCTCATGGG - Intronic
1157715619 18:49884723-49884745 CACAGGAGTCCCCAACCCCTAGG - Intronic
1157829862 18:50847342-50847364 CCCATGAGTCATCAACTTCTGGG + Intergenic
1158689109 18:59644315-59644337 ACCAGGGGTCCCCAACTCCTGGG - Intronic
1160416801 18:78717492-78717514 ACCCTGGGTCTCCACCTCCTGGG + Intergenic
1160527849 18:79547862-79547884 CCCACGAGCCCCCACCACTTTGG + Intergenic
1160680980 19:411495-411517 CCCCTGAGGCCCCCTCTCCTCGG - Intergenic
1160871922 19:1281634-1281656 CCCTCGACTCCCCACCTCCAGGG + Intergenic
1160898062 19:1412106-1412128 CCCCTGAATGCCCACATCCTGGG - Intronic
1161079024 19:2301172-2301194 ACCAGGGGTCCCCAGCTCCTGGG - Intronic
1161193500 19:2972861-2972883 CCCTGCAGTCCCAACCTCCTGGG - Intergenic
1161306918 19:3573556-3573578 CCCATCAGACCCTGCCTCCTCGG + Intronic
1162106714 19:8374150-8374172 CCTCTGAGTCCCCAACTCCCTGG - Exonic
1162126777 19:8503662-8503684 CACATGGGCCCCCACGTCCTGGG - Intergenic
1163153729 19:15429088-15429110 CCGGTGAAGCCCCACCTCCTGGG - Intronic
1163578063 19:18122142-18122164 CCCATGACCCCCCACCCCCTGGG - Intronic
1163579696 19:18130943-18130965 CCCATCAGTTCCCCCCACCTAGG - Intronic
1163704600 19:18804836-18804858 CTCATGGGTCCCCACTGCCTGGG - Intergenic
1164830262 19:31314764-31314786 CCCTTGAGTGTCCACCTCCGGGG + Intronic
1165242545 19:34480450-34480472 CCCCAGAGTCTCAACCTCCTGGG - Intergenic
1165750161 19:38254603-38254625 CCAATGAGGCCCCACCTCTAAGG + Intronic
1165752345 19:38267953-38267975 CCCCTGAGGGCACACCTCCTGGG - Intronic
1165904882 19:39187659-39187681 CCCAGGAGTCAGCACGTCCTGGG - Intergenic
1166076973 19:40419430-40419452 CCCAGGAGGCCACACCACCTTGG - Intergenic
1167599322 19:50445097-50445119 CTCCTGAGTCCCTTCCTCCTAGG - Intronic
1168108818 19:54180720-54180742 CCCAGCAGCCCCCACCTCCAAGG - Intronic
1168287924 19:55343571-55343593 CCCAGGAGTCCCTCCTTCCTGGG + Intronic
925427483 2:3762702-3762724 CCCACCAGGCCCCACCTCCAAGG + Intronic
926812005 2:16763639-16763661 CCCATGAGTCCACTGGTCCTTGG - Intergenic
926903558 2:17784884-17784906 CTCAGGAGTCCCCAACCCCTGGG + Exonic
927154239 2:20212565-20212587 CCAGTGAGGCCCCTCCTCCTGGG - Intronic
927518670 2:23686564-23686586 CCCGTGACACCTCACCTCCTTGG - Intronic
929904814 2:46036512-46036534 CACTGCAGTCCCCACCTCCTGGG - Intronic
930591232 2:53328695-53328717 CCCAGGGGTCCCCAACTCCCGGG - Intergenic
930718699 2:54618186-54618208 CCCTTGAGTCCCTACCTTCGGGG - Exonic
932302375 2:70676467-70676489 CCTATGAGTCCCCACTTCACGGG + Intronic
932593277 2:73079761-73079783 CCCATGAGCCCTCCCCACCTGGG - Intronic
932880348 2:75495311-75495333 CCCATGACTCCCTCTCTCCTAGG - Intronic
933327165 2:80852663-80852685 CCAATGAGGCCCCTCCTCCAAGG - Intergenic
933717273 2:85370705-85370727 CTAGTGGGTCCCCACCTCCTGGG + Intronic
934976154 2:98803926-98803948 CCCATGTGTCCCCAGGGCCTGGG - Intronic
937245114 2:120487446-120487468 CCCATCAGTCCCCGAGTCCTAGG - Intergenic
938302581 2:130227770-130227792 CCCTTGGCTCCCCACCTGCTTGG + Intergenic
938454101 2:131446484-131446506 CCCTTGGCTCCCCACCTGCTTGG - Intergenic
946027063 2:216678301-216678323 CCCTTCAGCCCCCACCCCCTGGG - Intronic
947525103 2:230872802-230872824 CCCATCAGTCACAGCCTCCTTGG + Intronic
948852249 2:240714173-240714195 CCCTGGAGTCCCCAGCACCTGGG - Exonic
1172887439 20:38240721-38240743 CCCCTGAGCCCCCCACTCCTGGG - Exonic
1173626410 20:44476091-44476113 CCCAGGTGTCCCCATTTCCTGGG - Intronic
1174401927 20:50280553-50280575 CCCATGCCTCCCTCCCTCCTGGG - Intergenic
1175838472 20:62011677-62011699 CCCTGGAGTCCACACCCCCTGGG + Intronic
1176110264 20:63407724-63407746 CCCAGGTCCCCCCACCTCCTGGG - Intronic
1176973872 21:15296163-15296185 AGCAGGAGTCCCCAACTCCTGGG - Intergenic
1178326862 21:31653673-31653695 CCCAGGGGTCCCCATCACCTGGG - Intergenic
1180747988 22:18104792-18104814 CCCATGATTCACCTCCTCTTTGG + Exonic
1180786395 22:18550045-18550067 CCCAGGAGTCCTCACCCCATGGG - Intergenic
1180846570 22:18986071-18986093 CCCATGGGGACCCAGCTCCTGGG - Intergenic
1181131677 22:20735771-20735793 CCCAGGAGTCCTCACCCCATGGG - Intronic
1181243317 22:21489598-21489620 CCCAGGAGTCCTCACCCCATGGG - Intergenic
1181443593 22:22951575-22951597 CCCATCAGTCTCCAGCCCCTGGG - Intergenic
1181494854 22:23282081-23282103 CGCCTGAGACCCCTCCTCCTTGG + Intronic
1182119891 22:27779776-27779798 CCCAGGCCTCCACACCTCCTCGG + Intronic
1182145557 22:27994782-27994804 CCCATTAGTCACCTCCTCCCAGG - Intronic
1182725504 22:32442075-32442097 CCCAGGAGTCCCCAGTCCCTGGG - Intronic
1183282136 22:36937658-36937680 GCCAGAAGTCCCCACCTCCAGGG + Exonic
1184548365 22:45189399-45189421 CCCTGGAGCCTCCACCTCCTGGG - Intergenic
1184586220 22:45449965-45449987 CACAGCAGTCTCCACCTCCTGGG + Intergenic
1184660732 22:45964426-45964448 CCCATGACTCCCCTCAGCCTGGG - Intronic
1185237116 22:49720529-49720551 CCCAGCAGCCCCCACCTCCTGGG + Intergenic
1185292936 22:50036167-50036189 CCCGTCAGTCCTCACCTGCTGGG - Intronic
949900448 3:8810458-8810480 CACAGCAGTCTCCACCTCCTGGG - Intronic
949920180 3:8994013-8994035 GCCATGTGCCTCCACCTCCTAGG - Intronic
949952256 3:9238853-9238875 CTCATGTGTCCCCCTCTCCTTGG - Intronic
952492083 3:33882528-33882550 CCCATGGGTCCCCACGGCTTGGG - Intergenic
952852994 3:37744359-37744381 TCCATCATTCCCCACCTTCTGGG + Intronic
952971966 3:38656963-38656985 CCCAGGAGACCCCCCCTCCCCGG - Intergenic
953066201 3:39473309-39473331 CCCATGTTCCCCCTCCTCCTGGG - Intronic
953344565 3:42164619-42164641 CCCAGGAGCACCCACCTCATGGG - Intronic
955703106 3:61701821-61701843 CCCTTCAGTCTCGACCTCCTGGG - Intronic
960784647 3:121358596-121358618 CCCACCAGGCCCCACCTCCTGGG + Intronic
961338431 3:126200095-126200117 CCCATGATTCCCTATCTCCTAGG + Intergenic
961467349 3:127089896-127089918 CCCAGGTGTCCCCTCCTCCAGGG - Intergenic
962069896 3:132022416-132022438 CCCATGAGGGGCCACCTCCTGGG - Intronic
962212108 3:133487610-133487632 CCCTACAGTCCCCACTTCCTGGG - Intergenic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
964383865 3:156126504-156126526 CCCAAGAGGCTCCCCCTCCTTGG - Intronic
964995519 3:162874501-162874523 TCCAGGGGTCCCCAACTCCTAGG + Intergenic
968914617 4:3491999-3492021 AACCTGAGTCCCCTCCTCCTGGG - Intronic
968976995 4:3827326-3827348 CTCACGTGTCCCCACCTCCTGGG + Intergenic
969386334 4:6851585-6851607 CGCCTGAGTCCCCAGCTACTTGG + Intronic
969635855 4:8369261-8369283 CTGGTGAGCCCCCACCTCCTGGG + Intronic
969866919 4:10082304-10082326 CCCAGGAGTCCCCATCTCCCAGG + Intronic
970869149 4:20794427-20794449 GCCAGGGGTCCCCAACTCCTGGG - Intronic
976179961 4:82389606-82389628 ACCAGGGGTCCCCAACTCCTGGG + Intergenic
976342388 4:83959523-83959545 CCCAGGGGTCCCCAACCCCTGGG - Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978680598 4:111377002-111377024 CCCAGGGGTCCCCAACCCCTGGG - Intergenic
979790966 4:124780845-124780867 ACCAGGAGTCCCCAACCCCTGGG + Intergenic
980614078 4:135195202-135195224 CCCACCAGGCCCCACCTCCTGGG - Intergenic
981375133 4:144006377-144006399 CCCAAGTCACCCCACCTCCTTGG - Intronic
983220304 4:165037600-165037622 GGCATGAGCCACCACCTCCTGGG + Intronic
983700144 4:170581681-170581703 ACCAGGAGTCCCCAACCCCTGGG - Intergenic
985345817 4:189002661-189002683 CCCTTGAGAGCCCACCTCCAGGG - Intergenic
985714581 5:1448216-1448238 CCCACGGGTCCCCCCCTCCTTGG + Intergenic
986112255 5:4731013-4731035 ACCAGGAGTCCCCAACCCCTGGG + Intergenic
986262787 5:6163044-6163066 CCCATGAGCCCCGCCCTGCTGGG - Intergenic
986936245 5:12891046-12891068 CCCATTGGCCTCCACCTCCTGGG + Intergenic
987228001 5:15863645-15863667 CCCACTAGGCCCCACCTCCCAGG - Intronic
987353548 5:17042550-17042572 CCCAGCACTCTCCACCTCCTGGG + Intergenic
996722267 5:126641500-126641522 CCCACCAGGTCCCACCTCCTAGG - Intergenic
997976865 5:138445991-138446013 CCGAGCAGTCCCCACCTCCTTGG - Exonic
1000814084 5:165899072-165899094 CCCAGGGGTCCCCAGCCCCTGGG + Intergenic
1001049302 5:168401562-168401584 CCCACAAGTCCCCACCGCCTGGG + Intronic
1002421901 5:179153323-179153345 CCCACCACTCCCCACCCCCTAGG - Intronic
1003611962 6:7621915-7621937 ACCATGACTCACCACCTCCATGG + Intergenic
1004099351 6:12592847-12592869 CACATCAGTCACCACTTCCTCGG + Intergenic
1004669326 6:17780906-17780928 CTCATCATTCCCCAACTCCTAGG - Exonic
1006091796 6:31632716-31632738 CCCAGGAGTTCCCACAGCCTTGG - Exonic
1006516991 6:34550698-34550720 CCCAACAGACCCCAGCTCCTGGG - Intronic
1007359150 6:41342745-41342767 CCCATGTGTCCCCTTCTCCCTGG - Intronic
1007401994 6:41607976-41607998 CCCAGGAGTCCCCAACCCCCAGG - Intergenic
1013803060 6:113969851-113969873 ACCAGGATTCCCCACCACCTAGG + Intronic
1017218553 6:151938695-151938717 CCCATAAGTTAACACCTCCTAGG + Intronic
1019357632 7:589142-589164 CCCATGACTCCCCATGCCCTTGG + Intronic
1019401147 7:854665-854687 GCCATGGGTCTCCACCTCCTGGG - Intronic
1022524131 7:31026691-31026713 CCCATGGGTTCCCACCACCTGGG - Intergenic
1024093192 7:45964636-45964658 GCCAGGAGTCCACACCTCCCAGG - Intergenic
1025993345 7:66512483-66512505 AGCAGAAGTCCCCACCTCCTGGG + Intergenic
1026848596 7:73711341-73711363 CCCATGAGTCCCCACTTTGATGG - Intronic
1026983592 7:74540591-74540613 AGCAGAAGTCCCCACCTCCTGGG + Intronic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1028181889 7:87733880-87733902 CGCAGGGGTCCCCACCCCCTGGG - Intronic
1029729414 7:102429655-102429677 CCCATGAGTCCTCTCCCCATCGG - Intergenic
1029883552 7:103843021-103843043 CCCAAGATTCCACAACTCCTTGG - Intronic
1030845199 7:114400822-114400844 CCCAGGGGTCCCCAACCCCTGGG - Intronic
1032461670 7:132116111-132116133 CCCAAGAGTCATCACCTCCCAGG - Intergenic
1032849987 7:135785977-135785999 CCCATGAGGCCCCTACTCCTAGG - Intergenic
1033579072 7:142715386-142715408 GCCATGGGCCCCCAGCTCCTTGG + Intergenic
1038780790 8:30567223-30567245 CAAATGCGACCCCACCTCCTTGG - Intronic
1039043100 8:33426566-33426588 CTCATGAGTCCCCATCCACTGGG + Intronic
1039131982 8:34275578-34275600 CCCATGAGCAGCAACCTCCTTGG + Intergenic
1039897923 8:41729514-41729536 CGCCTTAGTCCCCACCTACTTGG - Intronic
1041166684 8:55098973-55098995 CCCAGGGGTCCCCAATTCCTGGG - Intergenic
1044594341 8:93943366-93943388 GACAGGAGTCCCCACCTCTTTGG - Intergenic
1048355292 8:133648912-133648934 TTCCTGACTCCCCACCTCCTGGG + Intergenic
1049425992 8:142538129-142538151 CCCGTGGGTCCCCTCCTCCAGGG + Intronic
1049688832 8:143949985-143950007 CCCATGTGGCCCCTCCTCCTCGG - Intronic
1049855203 8:144857388-144857410 GCCTTGTGTCCCCACCTTCTGGG + Intergenic
1050511189 9:6397423-6397445 CACTGGAGTCTCCACCTCCTGGG - Intergenic
1050620909 9:7451074-7451096 TCCATGTGACACCACCTCCTCGG + Intergenic
1051454884 9:17244285-17244307 CACTTCAGTCTCCACCTCCTAGG + Intronic
1056506326 9:87261469-87261491 CCCATGTTTCTCCAACTCCTGGG - Intergenic
1057304599 9:93904864-93904886 ACCCTGAGCCCCCACCTGCTGGG + Intergenic
1058055220 9:100442236-100442258 CTCCTGAGTACCCACGTCCTAGG + Exonic
1058754998 9:108075897-108075919 CCTCTGATGCCCCACCTCCTCGG + Intergenic
1059383466 9:113946458-113946480 CCCAGGACTCCCCATTTCCTTGG - Intronic
1060160878 9:121362005-121362027 ACCAGGAGTCCCCAACTCCCAGG - Intronic
1060807248 9:126585625-126585647 CTCATGGGTCCCCATCTCCCTGG - Intergenic
1061949059 9:133926077-133926099 CCTGTGAGTCCCCACCCCGTTGG - Intronic
1185752604 X:2626188-2626210 GTCATGTGTCCCCACCTCTTAGG + Intergenic
1187470454 X:19565003-19565025 CCCATGAGCCCAAACCTTCTAGG - Intronic
1187633178 X:21197466-21197488 CCCATAAAGCCCCACCTCCTGGG + Intergenic
1187842644 X:23504926-23504948 CCCAGGACTCCCCACCTCCAGGG - Intergenic
1190188288 X:48255026-48255048 CCTATCCCTCCCCACCTCCTCGG - Intronic
1190681627 X:52831171-52831193 CCCACCTGTCCCCAGCTCCTGGG - Intergenic
1190998699 X:55637155-55637177 CCCACTTGTCCCCAGCTCCTGGG - Intergenic
1192243925 X:69357920-69357942 CCCATGGGCCCCCAGCTCCCAGG + Intergenic
1195219210 X:102730424-102730446 CTCAGGAGTCCCCAGCCCCTAGG - Intronic
1197911896 X:131491939-131491961 CCCCTGAGTCCTCACCCCTTGGG + Intergenic
1198241439 X:134791231-134791253 CCCATTAGCCAGCACCTCCTTGG - Intronic
1199303158 X:146236239-146236261 TTCATAATTCCCCACCTCCTAGG - Intergenic
1200990251 Y:9339218-9339240 CCCATGTGTTCCCAGCTGCTTGG + Intronic
1201003407 Y:9489021-9489043 CCCATGTGTTCCCAGCTGCTTGG + Intronic
1201011298 Y:9549784-9549806 CCCATGTGTTCCCAGCTGCTTGG + Intergenic