ID: 918378786

View in Genome Browser
Species Human (GRCh38)
Location 1:183934476-183934498
Sequence CACGCCCACATGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918378786 Original CRISPR CACGCCCACATGATGTTTTG TGG (reversed) Intronic
900718801 1:4161734-4161756 CCCGCCCCCATGAGGTTTGGTGG - Intergenic
901849131 1:12004312-12004334 AACGCCCACATGATCTGTGGAGG - Intronic
904380595 1:30107998-30108020 CACACTCACATGGTGTATTGTGG - Intergenic
904976106 1:34457828-34457850 CACCCCCATAATATGTTTTGGGG + Intergenic
907654663 1:56330084-56330106 CAGGGCCACATGATGATTAGTGG - Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG + Intergenic
921666647 1:217880803-217880825 CTCACCAACAGGATGTTTTGGGG + Intergenic
924334934 1:242978126-242978148 CACCACCAAAAGATGTTTTGGGG - Intergenic
1064338026 10:14461165-14461187 CTCCCCCACGGGATGTTTTGTGG + Intronic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1081193099 11:40128361-40128383 CAGACCCACATTATGTTTTAAGG - Intronic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1092492021 12:8954059-8954081 CATGTCCATATGATTTTTTGAGG + Intronic
1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG + Intronic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1100681651 12:96930246-96930268 CACTCTCACATGCTGTGTTGGGG + Intronic
1104434605 12:128745837-128745859 CAAAACCATATGATGTTTTGGGG - Intergenic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1119645652 14:76346537-76346559 CAAGCCCCCATGGTGTCTTGAGG - Intronic
1129266687 15:74397093-74397115 CACGCCCACATCAGGTATTGTGG - Intergenic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG + Intergenic
1134028056 16:10969714-10969736 CATGCCCAGATGTTGTCTTGGGG + Intronic
1134401104 16:13910506-13910528 CAAGCCCAGATGGTGTTTTTAGG - Intergenic
1134669546 16:16044643-16044665 CACGACCTGATGATGTTTTCCGG + Exonic
1136683883 16:31983128-31983150 GACGCCCACATGACTTTGTGTGG - Intergenic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1140879772 16:79187569-79187591 CACGCCCAGCTGATTTTTAGTGG + Intronic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1147144811 17:38478831-38478853 GACGCCCACATGACTTTGTGTGG - Intronic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1157268891 18:46254376-46254398 CACACCAACTTGATGTCTTGTGG - Intronic
1158251353 18:55491255-55491277 CCCGCCCCCATGATGGTCTGGGG - Intronic
1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG + Intronic
1164231017 19:23288909-23288931 TATGCCCACATGAGGTTTTTGGG - Intergenic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG + Intronic
1167908288 19:52680443-52680465 GACTCCTCCATGATGTTTTGTGG - Intronic
925733218 2:6937736-6937758 CACGGCCAGGTGATGTTTGGAGG + Intronic
926159740 2:10479013-10479035 CACACCCACATGCTGCTGTGCGG - Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
930035720 2:47083941-47083963 CACTCCTACATGATTTTCTGGGG - Intronic
931364875 2:61610435-61610457 TACTCCCAAAAGATGTTTTGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG + Intronic
940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG + Intronic
945163988 2:206922782-206922804 CATGCCCACAAGATGCTCTGTGG + Intergenic
945357637 2:208857924-208857946 CACACCCACATGAAGTGCTGTGG - Intergenic
948307265 2:236957646-236957668 CACCTCTAAATGATGTTTTGAGG + Intergenic
1170509613 20:17063398-17063420 CACTCCCTCATTGTGTTTTGTGG - Intergenic
1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG + Intronic
1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG + Intronic
1181803552 22:25362001-25362023 CATGGCCACATGATGTTGAGGGG - Exonic
951457102 3:22904831-22904853 AACACCCCCATCATGTTTTGTGG + Intergenic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
952654229 3:35764693-35764715 CAAGCCTAGATAATGTTTTGTGG + Intronic
957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG + Intronic
965759803 3:172063665-172063687 AATGATCACATGATGTTTTGAGG + Intronic
967515806 3:190366973-190366995 CACTCCCACATGCTGCTTTGGGG - Intronic
969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG + Intronic
970545747 4:17128366-17128388 CACTCCAAGATGCTGTTTTGTGG - Intergenic
974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG + Intergenic
976518963 4:86004400-86004422 CACACACACAGGGTGTTTTGTGG + Intergenic
979492011 4:121338928-121338950 CATCCCCACATGCTGTTTTCAGG + Intronic
980516515 4:133869157-133869179 CACGTCCAGCTAATGTTTTGGGG - Intergenic
984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG + Intergenic
985859422 5:2458793-2458815 CACGCACACACAATGTTTTCTGG + Intergenic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG + Intronic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
998565798 5:143214832-143214854 GACGCCCACATGCAGTTCTGGGG - Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999149649 5:149418254-149418276 CACACCTACATGATGTGGTGGGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1008951730 6:57168482-57168504 CAAGGCCACTTGATGTTGTGTGG - Exonic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1017546723 6:155459806-155459828 AAAGCCCACATCATCTTTTGTGG - Intergenic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG + Intergenic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1025739456 7:64183651-64183673 CAGGCTCACAGGTTGTTTTGTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1043784254 8:84377308-84377330 TTAGCCCACATGATATTTTGAGG - Intronic
1044964396 8:97561095-97561117 TCCGCCCACATGATTTTTGGGGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1047926104 8:129684077-129684099 CAGGCACAAATGATGTTTTCAGG - Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049958841 9:718907-718929 TAAGCCCAAATGATGGTTTGGGG - Intronic
1051880823 9:21838036-21838058 CAAGCCCACATGATTTATTCTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055376556 9:75654844-75654866 TAAACCCACAAGATGTTTTGTGG - Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG + Exonic
1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG + Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic