ID: 918381280

View in Genome Browser
Species Human (GRCh38)
Location 1:183958080-183958102
Sequence ATTTGGGGATGTGCTGCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918381280_918381284 29 Left 918381280 1:183958080-183958102 CCGAAGGCAGCACATCCCCAAAT 0: 1
1: 0
2: 1
3: 16
4: 197
Right 918381284 1:183958132-183958154 AGTTATCACATGAAAAGAGATGG 0: 1
1: 0
2: 5
3: 30
4: 378
918381280_918381285 30 Left 918381280 1:183958080-183958102 CCGAAGGCAGCACATCCCCAAAT 0: 1
1: 0
2: 1
3: 16
4: 197
Right 918381285 1:183958133-183958155 GTTATCACATGAAAAGAGATGGG 0: 1
1: 0
2: 1
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918381280 Original CRISPR ATTTGGGGATGTGCTGCCTT CGG (reversed) Intronic