ID: 918381280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:183958080-183958102 |
| Sequence | ATTTGGGGATGTGCTGCCTT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 215 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 197} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918381280_918381284 | 29 | Left | 918381280 | 1:183958080-183958102 | CCGAAGGCAGCACATCCCCAAAT | 0: 1 1: 0 2: 1 3: 16 4: 197 |
||
| Right | 918381284 | 1:183958132-183958154 | AGTTATCACATGAAAAGAGATGG | 0: 1 1: 0 2: 5 3: 30 4: 378 |
||||
| 918381280_918381285 | 30 | Left | 918381280 | 1:183958080-183958102 | CCGAAGGCAGCACATCCCCAAAT | 0: 1 1: 0 2: 1 3: 16 4: 197 |
||
| Right | 918381285 | 1:183958133-183958155 | GTTATCACATGAAAAGAGATGGG | 0: 1 1: 0 2: 1 3: 19 4: 253 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918381280 | Original CRISPR | ATTTGGGGATGTGCTGCCTT CGG (reversed) | Intronic | ||