ID: 918385744

View in Genome Browser
Species Human (GRCh38)
Location 1:184005635-184005657
Sequence ACGGAGAGGCAGAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 488}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918385744_918385752 19 Left 918385744 1:184005635-184005657 CCATCCACACTCTGCCTCTCCGT 0: 1
1: 0
2: 3
3: 32
4: 488
Right 918385752 1:184005677-184005699 CAGTCATATCTCTGCAGAGCTGG 0: 1
1: 0
2: 3
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918385744 Original CRISPR ACGGAGAGGCAGAGTGTGGA TGG (reversed) Intronic
900162360 1:1230108-1230130 CCGGAGGGGCAGACTGTGAAAGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901451890 1:9340901-9340923 GCGGGGAGGCAGAGTGGGAAGGG + Intronic
901476730 1:9495106-9495128 CCGGAGGGGCAGAGCGGGGAGGG + Intergenic
901690363 1:10969246-10969268 ACCGAGATGCAGAGCATGGAGGG + Intronic
902930626 1:19728769-19728791 ATGGAAAGGCAGAGTGGGGCAGG - Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903480866 1:23652401-23652423 ACAGAGAGGGAGAGGGAGGAGGG + Intergenic
903947180 1:26971323-26971345 ACGGTGAGGCAGGGTGGGGTGGG + Intergenic
904966486 1:34378343-34378365 ACAGGGAGCCTGAGTGTGGAGGG - Intergenic
905364530 1:37442415-37442437 ACAGAGAGAGAGAGAGTGGAGGG - Intergenic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906783200 1:48590777-48590799 ACGGGGAGGCAGGGTGTGGGGGG + Intronic
907246286 1:53111148-53111170 ACAGAGAGGCAGAGCCTGGGAGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908316458 1:62937501-62937523 GAGGAAAGGCAGAGTGTGGCTGG - Intergenic
910262674 1:85307208-85307230 ACTGAGAGGCTGAGTAAGGATGG + Intergenic
910547438 1:88433604-88433626 AGGGAGGGGCACAGTGTGGCTGG + Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
911009028 1:93260056-93260078 ACTTAGAGGCTGAGTGGGGAGGG - Intronic
911712728 1:101094231-101094253 TCGGAGAGGCAGAGCGTATATGG - Intergenic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
916893527 1:169137478-169137500 AGGGTGAGGCAGATTATGGAAGG + Intronic
918248961 1:182684777-182684799 AGGGAGAGGCAGAGTTCAGAGGG + Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918617098 1:186557494-186557516 AAGAAGAGACAGAGAGTGGAGGG - Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919980119 1:202637736-202637758 AGGGAGGGGCAGAGGGTGAAAGG - Intronic
920294773 1:204949221-204949243 GAGGAGGGGCAGAGTGTGGCAGG - Intronic
920650163 1:207831683-207831705 CCAGAGAGACAGAGTGTGGTTGG + Intergenic
921311923 1:213853135-213853157 AGGCAGAGGCAGAGGGTGGCAGG - Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
923097741 1:230788865-230788887 ATGGAGATCCAGAGTTTGGAAGG + Intronic
923552747 1:234977202-234977224 AAGGAGAGGCTGAGTAGGGAGGG + Intergenic
923907023 1:238395947-238395969 ATGGAGAGGTAGTGTGTGCAAGG - Intergenic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924652869 1:245946643-245946665 ACGTACAGGCAGAGTGGGGAGGG + Intronic
1063044100 10:2373887-2373909 AAGGAGAGACAGAGGCTGGAAGG - Intergenic
1063533303 10:6857185-6857207 ACGATGAGGCAGAGTTGGGATGG + Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064280788 10:13949738-13949760 ACTAAGAGCCAGAGTGTGTAAGG + Intronic
1064414451 10:15136406-15136428 ACAGAGAGGGAGAGGGAGGAAGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1065359090 10:24872267-24872289 AGGGAGAGGCTGGGTGTGCAGGG + Intronic
1065828462 10:29593571-29593593 GCCGGGAGGCAGAGAGTGGAAGG - Intronic
1065945910 10:30605450-30605472 GGGGAGGGGCAGAGAGTGGAGGG - Intergenic
1066199042 10:33128124-33128146 AGGGAGGGGAAGAGGGTGGAGGG - Intergenic
1066507470 10:36060336-36060358 AGGAAGAGACAGAGTGGGGAGGG + Intergenic
1066771198 10:38847320-38847342 ACGGAAAGGAATAGAGTGGAAGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067089617 10:43259906-43259928 ACGGAGGGGCAGGGCGGGGACGG + Intronic
1067311288 10:45115891-45115913 ATGGAGAGAAAGAGAGTGGAAGG - Intergenic
1067481149 10:46598324-46598346 AGGGAGAGGTAGTGTTTGGAAGG - Intergenic
1067613603 10:47743498-47743520 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1068667812 10:59696079-59696101 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069926569 10:71854785-71854807 AGGGAGAGGGACAGGGTGGAGGG - Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071629013 10:87203470-87203492 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1072400919 10:95099160-95099182 ACGGGGAGGCAGAGGTTGCAGGG - Intergenic
1072564607 10:96607184-96607206 GCAGAGAGGGAGAGTGAGGATGG - Intronic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1074334374 10:112554786-112554808 AGGGAGAGGTAGAGAGTGGGAGG - Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1076851415 10:133095274-133095296 ACAGAGGGGCAGAGTGAGGGTGG + Intronic
1077096052 11:799618-799640 ACTCCGAGGCAGAGTGTGGTGGG - Intronic
1077182096 11:1221320-1221342 CCGCAGAGACGGAGTGTGGACGG - Intergenic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1078004070 11:7519218-7519240 AGGGAGAGGTAGAGTCTGGGAGG + Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078699284 11:13665526-13665548 CCGGAGAGGCAGAGCTTGCAGGG + Intergenic
1078767578 11:14313661-14313683 AGGCAGAGGCAGAGATTGGAGGG + Intronic
1079080544 11:17410663-17410685 AGGGAGAGGAAGAGAGTAGAGGG + Intronic
1079169997 11:18084435-18084457 CCAGAGAGGTAGAGTATGGAGGG - Intronic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1083155648 11:60821340-60821362 ACAGAGAGGTGGAGTGTTGAGGG + Intergenic
1083205592 11:61146908-61146930 AGCGACAGGCAGAGTGTGTATGG + Intronic
1083611865 11:64008199-64008221 AGGGAGAGGCAAAGCGTGGAGGG + Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084126561 11:67102917-67102939 AGAGAGAGGCAGAGTGTAGGCGG - Intergenic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085279231 11:75319476-75319498 ACAGAGAGGCAGGGTGGGAAGGG - Intronic
1085531617 11:77195238-77195260 AGGGAGAGGCAGAGGCTGGCGGG - Intronic
1085803351 11:79611780-79611802 ATGCTGAGGCAGAGTGTGGGAGG + Intergenic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087903244 11:103666284-103666306 CAAGAGAGGCAGAGTGTGCAGGG - Intergenic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1090261258 11:125322365-125322387 ACGAAAGGGCAGAGTCTGGAGGG - Intronic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091135545 11:133185605-133185627 AGGGAGAGGCAGAGAATAGATGG + Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093692339 12:22122343-22122365 TAGGAGGGGCAGAGTGTGGTTGG - Intronic
1093707301 12:22288586-22288608 AAGGGGAGGCACAGTGTGGCAGG - Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094435974 12:30421197-30421219 ACCAAGAGGCAGAGGCTGGAGGG - Intergenic
1094450425 12:30577963-30577985 AGGGAAATGCAGAGTGTAGAGGG + Intergenic
1094717523 12:33027930-33027952 ACTAAAAGGCAGAGTGTGGCAGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096624953 12:52889040-52889062 AAGGTGAGGAAGAGTGTGCATGG - Intergenic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1100067239 12:90664177-90664199 ACAGAGAGGGAGAGTGTGATAGG + Intergenic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103517268 12:121515481-121515503 AGGGGGTGGCAGAGTGTGGTTGG - Intronic
1103823580 12:123717998-123718020 CCCGAGAGGCAGAGGTTGGATGG - Intronic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104804921 12:131581618-131581640 ACAGACAGGCAGAGTGCAGAGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107354056 13:39546967-39546989 AGGCAGAGGCAGAGTCTGAAAGG - Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109815534 13:67577878-67577900 AAGGAGTGGCAGAGTTTGAAAGG - Intergenic
1110279460 13:73675937-73675959 ACAGAGGGGCAGAGAGTGGCAGG + Intergenic
1111356591 13:87114170-87114192 AAGAAGAGGCCGAGTGTGCATGG - Intergenic
1112020773 13:95369380-95369402 CAGGAGAGGGAGAGTGTGCAGGG + Intergenic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115539962 14:34411279-34411301 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1120495882 14:85234686-85234708 AGGGAAAGGCAATGTGTGGATGG - Intergenic
1120743989 14:88137472-88137494 TTGGAGAGCCTGAGTGTGGAAGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121108645 14:91297049-91297071 CGGGAGAGGCACAGTGGGGACGG - Intronic
1121124327 14:91396203-91396225 ACGGAGAGGCAGAGCCTGCCTGG + Intronic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123154288 14:106209539-106209561 GAGGAGAGGAACAGTGTGGAAGG + Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124495733 15:30185781-30185803 AGGGAGGGGCAGAGGGTGAAAGG - Intergenic
1124671845 15:31647864-31647886 ACAGGGAGGCAGTGTGTGCAGGG + Intronic
1124747840 15:32352865-32352887 AGGGAGGGGCAGAGGGTGAAAGG + Intergenic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1124904701 15:33857679-33857701 ACGAGGAGGAAGAGTGAGGACGG - Intronic
1126186052 15:45831318-45831340 ACGGGGAGGCAGAGTGTGCAGGG + Intergenic
1126809064 15:52382328-52382350 ACTGGGAGGCCGAGTGGGGACGG + Intronic
1129681462 15:77660722-77660744 GTGGACAGGCAGAGAGTGGAGGG + Intronic
1129849516 15:78784393-78784415 AGGGAGAGGAAGAGGGGGGAGGG + Intronic
1130244752 15:82236180-82236202 AAGGAGAGGCATAGTGTTCATGG + Intronic
1130455888 15:84106962-84106984 ATGGAGAGGCATAGTGTTCATGG - Intergenic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131431912 15:92394508-92394530 GCGGAGGGGCCGAGAGTGGAGGG + Intronic
1131646237 15:94348365-94348387 ACGGAGAGGGAGAGAGAGAAGGG - Intronic
1133476851 16:6131838-6131860 ACAGAGAGCCAGAGAGTGGCAGG - Intronic
1134231729 16:12435151-12435173 ACGGAGAGGCAGAGGGCAGCAGG - Intronic
1135120284 16:19760602-19760624 AGGGAAAGGCAGAGTGTTAAGGG - Intronic
1136031625 16:27507306-27507328 ACAGAGAGGAAGAGCCTGGAGGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136591312 16:31219374-31219396 ACCGCGAGGCAGAGCGTGTACGG + Exonic
1136665792 16:31811223-31811245 ACGGCCAGGGAGTGTGTGGAGGG + Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137541708 16:49367399-49367421 AAGGAGAGGCAGAGTGGGTCTGG - Intergenic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1138383184 16:56617746-56617768 ACATAGAGGCACAGTGAGGAGGG - Intergenic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139518673 16:67466980-67467002 AGGGAGAGCAAGAGTGTAGAGGG - Intronic
1139593040 16:67943749-67943771 ACTGAGAGTCACAGTGTGGTGGG + Exonic
1139953130 16:70681454-70681476 GGGCAGAGGCACAGTGTGGAGGG + Intronic
1141556384 16:84839308-84839330 ACCTGGAGGCAGAGTGGGGAGGG + Intronic
1141879644 16:86849310-86849332 AAGGTGAGGCAGGGTGTGAAAGG - Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142258790 16:89032470-89032492 ACTGAGATGTAGCGTGTGGATGG - Intergenic
1142296912 16:89230211-89230233 AAGGAGGGGCAGAGTGGAGAGGG + Exonic
1142769847 17:2088743-2088765 ACTGAGAGGCAGAATGTCCAGGG + Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1145007714 17:19346842-19346864 GCGCAGAGGCTTAGTGTGGAGGG - Intronic
1146939863 17:36836891-36836913 AAAGAAAGGCAGAGTGTGGGTGG + Intergenic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147740679 17:42669628-42669650 ACAGAGAGGCAGAGTCAGGGTGG + Intronic
1147789315 17:43003467-43003489 AAGGAGGGGCAGAGTGTGTGTGG - Intergenic
1148760867 17:49999254-49999276 ACGGAGCATCAGAGTTTGGATGG - Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149890705 17:60387458-60387480 ACGGAAATACAGAGTGTGTATGG - Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150227118 17:63530250-63530272 CCGGTGAGGCAGAGTGAGGGTGG + Exonic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152803851 17:82345383-82345405 ACGTAGACGTAGCGTGTGGAAGG + Intergenic
1153190520 18:2532755-2532777 ACAGAGGGGCAGAGGCTGGAAGG + Intergenic
1154489182 18:14906225-14906247 AGGGAGAGGCAGAGACTGGCAGG - Intergenic
1156503235 18:37572950-37572972 AGGGAGAGGCTGAGGATGGAGGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157481040 18:48053978-48054000 GCGCAGAGGCTGAGTGAGGATGG + Intronic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159012573 18:63071902-63071924 ACGGAGTGGCAGAGTGGTGTTGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1160153698 18:76415537-76415559 ACGGAGAGGCAGGTTCTGCATGG - Intronic
1161305710 19:3566417-3566439 AGGGAGAGTCAGGGTGTGGTTGG - Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161395486 19:4043006-4043028 GCAGAGAGGCTGGGTGTGGATGG - Intergenic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162100883 19:8337970-8337992 AAGGAGAGGCCATGTGTGGAGGG - Intronic
1162473799 19:10887964-10887986 AATGAGAGCCAGGGTGTGGAGGG + Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1165429984 19:35767023-35767045 ACAGAGAGAGAGAGGGTGGAGGG - Intronic
1165495589 19:36150638-36150660 AGGCAGAGGCCAAGTGTGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166750699 19:45162795-45162817 ACGGGGAGGGAGGGAGTGGAGGG + Intronic
1167149967 19:47702689-47702711 ACAGAGGGGCAGAGTGTGCCAGG - Exonic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929483916 2:42338285-42338307 AAGGAAAGGCAGAGGCTGGATGG - Intronic
930363440 2:50410744-50410766 AAGGAGATGCAGAGTATAGATGG + Intronic
931195351 2:60047508-60047530 AGGGAGATACAGAGTGTGGCTGG + Intergenic
931786278 2:65622033-65622055 ACATAAAGGCAAAGTGTGGAGGG + Intergenic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
935144206 2:100383462-100383484 AGGGAGTGGCAGAGTATGGCAGG + Intergenic
935210842 2:100938499-100938521 ACGGAGGGAAAGAGTGGGGAGGG - Intronic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
937098722 2:119252367-119252389 AGGGGGTGGCAGGGTGTGGAAGG - Intronic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
937820774 2:126308159-126308181 AAGGAGAGGCTGAGTTTGGCTGG - Intergenic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
939796349 2:146649516-146649538 ACCTAGAGACAGAGTGTGGTAGG + Intergenic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941911737 2:170770933-170770955 ACGGAGAGGCAGGGTGGAGGCGG - Intergenic
943866698 2:192933486-192933508 AATGAGAGGTGGAGTGTGGATGG - Intergenic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
946352550 2:219164884-219164906 AGGGAGAGGCAGACAGTTGAAGG - Intronic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
946753100 2:222913448-222913470 AAGGAGAGGGACAGTTTGGAAGG - Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948068060 2:235096893-235096915 AGGCAGAGGCAGAGATTGGAGGG - Intergenic
948487142 2:238288329-238288351 AAGGTGAGGCAGCGTGTGTAGGG - Exonic
948634142 2:239323534-239323556 TCGGAGAGCCTGTGTGTGGAAGG + Intronic
948866675 2:240778636-240778658 ACCGGGAGGAAGTGTGTGGAAGG - Intronic
1169151846 20:3295613-3295635 ACTGAGAGGGAGCGTGAGGATGG + Intronic
1170981059 20:21213295-21213317 AGGGAGAGTCAGAGCATGGAAGG - Intronic
1171393520 20:24816311-24816333 AAGTAGAGGCAGAATGTGGGTGG + Intergenic
1171452613 20:25247138-25247160 AGGGAAAGGCAGAGTTTGAAGGG + Intergenic
1171752280 20:29062955-29062977 ATGGAAGGGCAGCGTGTGGAAGG - Intergenic
1172548631 20:35781617-35781639 ACGGAGATGGAGAGTGGTGATGG - Intronic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173804846 20:45917797-45917819 AGGGACAGGCTGAGTGGGGAAGG - Intergenic
1174544797 20:51317361-51317383 AAGGGGTGGTAGAGTGTGGAAGG - Intergenic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1180171395 21:46060553-46060575 ACTGAGAGCCAGGGTGGGGAAGG - Intergenic
1180715866 22:17871923-17871945 ATGGAGAGGCTGAGTGCCGAGGG - Exonic
1180923810 22:19538256-19538278 ACGGAGAGAGGGAGGGTGGAGGG + Intergenic
1180979237 22:19871016-19871038 TCTGGGAGGCAGAGTGTGGGAGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181757948 22:25038763-25038785 AAGGAGGGGCACAGTTTGGATGG + Exonic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1182111260 22:27725335-27725357 ACAGAGTGGCAGAGTGGGGCTGG - Intergenic
1182453290 22:30433746-30433768 ACGGGGTGGCAGAGTGGGGAGGG - Intergenic
1182582493 22:31323021-31323043 ACTGAGAGGTAGAGTTTGTAAGG + Intergenic
1183097545 22:35562212-35562234 AGGGAAAGGCAGAGGGGGGAGGG + Intergenic
1183359974 22:37378458-37378480 GCGAAGAGGCTGAGCGTGGAGGG + Intronic
1183551005 22:38485303-38485325 GTGGGGAGGCAGAGTGTGAAGGG + Exonic
1183935232 22:41258112-41258134 AAGAGGAGGCAGAGAGTGGAGGG + Intronic
1184652804 22:45926825-45926847 GCCGAGAAGGAGAGTGTGGAGGG + Intronic
1185015287 22:48339272-48339294 AGGGACAGGGAGAGTGCGGAGGG + Intergenic
1185264151 22:49889825-49889847 ACGGAGAGGCAAGGTGGGAATGG - Exonic
949483984 3:4519892-4519914 AAGGAGAGGCAGAGAGTGTCTGG + Intronic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
950460564 3:13119895-13119917 TGAGTGAGGCAGAGTGTGGACGG - Intergenic
950585655 3:13890532-13890554 CCGGTGAGGCAAAGTGTGGCTGG - Intergenic
955155730 3:56414767-56414789 AGGGAGAGAGAGAGAGTGGAAGG - Intronic
956144258 3:66176378-66176400 ACACAGAGGAAGTGTGTGGATGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
962436388 3:135370953-135370975 ATAGAGTGGCAGAGAGTGGAAGG - Intergenic
962454062 3:135549007-135549029 AGTGAGAGCCCGAGTGTGGAAGG - Intergenic
962685597 3:137844955-137844977 AGGGAGAGGGAGAGGATGGATGG - Intergenic
962990495 3:140573200-140573222 AGGGCCTGGCAGAGTGTGGAGGG + Exonic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
968288164 3:197520142-197520164 GCAGAGTGGCAGAGTGTGGAGGG + Intronic
969446614 4:7248234-7248256 GCTGAGAGGCTGTGTGTGGAGGG + Intronic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
970048558 4:11884160-11884182 AAGGAAAGATAGAGTGTGGAAGG + Intergenic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
972012602 4:34203652-34203674 AGGAAGAGGCAGTGTGTTGAGGG + Intergenic
972544894 4:40071153-40071175 AAGGAGAGGCAGAGTAGAGAAGG - Intronic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973312150 4:48721261-48721283 TCAGAGAGGTAGAGAGTGGAGGG + Intronic
974055542 4:56979160-56979182 AGGGAGAGGCGGAGGGTGCAGGG + Intronic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977600724 4:98931330-98931352 AGGGAGAGGAAGGGTGGGGAAGG - Intergenic
978523293 4:109638722-109638744 AAGCAGTGGCAGAGTTTGGAGGG - Intronic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
981132652 4:141175114-141175136 AGGGAAAGGCAGAGTGCTGATGG + Intronic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981716857 4:147760477-147760499 GGGGAGAGGCAGAGTCTGGGTGG + Intronic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
985126876 4:186703181-186703203 GCGTAGTGGCAGAGTGGGGATGG - Intronic
985275257 4:188232236-188232258 AAGAAGAGGCAGGGTGTGGGTGG - Intergenic
985907478 5:2852158-2852180 ACAGAGAGGCAGAGGCTGGGTGG - Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
986523126 5:8642991-8643013 AGAGAGAGGCAGAGTGTGCCTGG - Intergenic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
986855445 5:11863683-11863705 TAGAAGAGGCAAAGTGTGGATGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997658227 5:135570802-135570824 ACTGGGGGGCAGTGTGTGGAGGG + Exonic
998158159 5:139797629-139797651 ACTGAGAGAGAGAGTGTGGCTGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000379661 5:160617337-160617359 AGGGAGAGGTAGAGAGTGGTAGG + Intronic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000833466 5:166130203-166130225 AAGGAGAGCTAGAGTGTGGGGGG + Intergenic
1001034063 5:168284354-168284376 ATGGGGAGGTAGAGAGTGGAGGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001867014 5:175114537-175114559 ATAGAGATGCAGAGTGTGAATGG - Intergenic
1001944573 5:175768071-175768093 AGGCAGAGGCTGAGTGTGAAAGG - Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1003087705 6:3074188-3074210 ACGGTGAGGCTGAGTGGGCAGGG - Intronic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1006133359 6:31881665-31881687 AGGGACAGGCAGTGAGTGGATGG + Intronic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1007388672 6:41536987-41537009 ACAGACCGGCAGAGTGTGGCAGG + Intergenic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1007402633 6:41612464-41612486 ACGGAGTGGCAGAGTGGGGTAGG - Intergenic
1012442150 6:99270622-99270644 AGGGAGGGGCTGAGTGTGGGAGG - Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017524448 6:155230279-155230301 ACAGAGAGGCAGGGTCTGGCAGG - Intronic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1018829681 6:167433462-167433484 GTGGGGTGGCAGAGTGTGGATGG + Intergenic
1018829748 6:167433765-167433787 TCGTGGTGGCAGAGTGTGGATGG + Intergenic
1018829884 6:167434379-167434401 TCGTGGTGGCAGAGTGTGGATGG + Intergenic
1019057856 6:169236006-169236028 TGGGGGAGGGAGAGTGTGGATGG - Intronic
1019279550 7:192978-193000 CCGGAGAGGCCGAGCGGGGACGG + Exonic
1019669796 7:2271282-2271304 TCGGAGAGGCCGAGGCTGGATGG - Intronic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022012791 7:26323519-26323541 GAGGAGAGGAAGAGAGTGGAAGG + Intronic
1022221607 7:28319552-28319574 ACCGAAAGGCACTGTGTGGATGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022659098 7:32349391-32349413 AGGGACTGGGAGAGTGTGGAGGG + Intergenic
1022715054 7:32891583-32891605 CCGGAGGGGCCCAGTGTGGACGG - Exonic
1022977769 7:35574799-35574821 AGAGAAAGGCAGAGTCTGGAAGG + Intergenic
1023351011 7:39320231-39320253 ACGGAGATTCAGAATCTGGAAGG - Intronic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1024175849 7:46840398-46840420 GTGGAGAGGTGGAGTGTGGAGGG - Intergenic
1024233416 7:47379997-47380019 CCAGAGAGGCAGTGTGTGGCTGG - Intronic
1024607108 7:51031055-51031077 ACGGAGACGCAGATTGTTCATGG + Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027753681 7:82183895-82183917 AAGAAGAGTCAGAGTGTGGGTGG - Intronic
1028730447 7:94141919-94141941 ACGGAGAGGGAAAGTGTGAGAGG + Intergenic
1029407353 7:100383494-100383516 GGGAAGAGGCAGAGGGTGGAAGG + Intronic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1031219127 7:118941287-118941309 ACAAAGAGGCAGATTGTTGAGGG - Intergenic
1032804712 7:135342377-135342399 TCAGAGAGGCAGAGTGTGTTGGG + Intergenic
1033305715 7:140223927-140223949 ACGGAGTGGCTGAGGGTGGAAGG - Intergenic
1034547088 7:151796257-151796279 ACAGAGAGCCACAGTGTGGGCGG - Intronic
1034996439 7:155580203-155580225 ACAGAGAGGAAGAGACTGGAAGG + Intergenic
1035092390 7:156324724-156324746 AAGGAGAGGGAGAGAGTGGGAGG + Intergenic
1035404772 7:158589708-158589730 AGGGAGAGGGAGAGAGTTGAGGG - Intergenic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1036812882 8:11879844-11879866 AAGGACAGGCAGAGTGGGGCAGG - Intergenic
1036912509 8:12768911-12768933 ACAGTCAGGCAGAGTGTGGCAGG + Intergenic
1037610108 8:20468935-20468957 ATGGAGAGGCTGAGTGTAAAAGG - Intergenic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039789942 8:40867512-40867534 ACGAAGAGGCAGAGGGTGGAGGG - Intronic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1044102903 8:88162764-88162786 ACAGAGAGACAGAGAGTGAAGGG - Intronic
1044935790 8:97292422-97292444 ACGGGGAGGCAGGGTGGTGAAGG + Intergenic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1046538401 8:115547338-115547360 ACGGAGAGGCAGAGGGAGAGAGG - Intronic
1046641494 8:116736584-116736606 CCGGGGAGGCAGAGTTTGCAGGG + Intronic
1047587538 8:126289936-126289958 GAGGAGTGGCTGAGTGTGGAAGG - Intergenic
1047717760 8:127611300-127611322 ACACAGAGGCAGAGACTGGAGGG + Intergenic
1048345553 8:133572118-133572140 ACGGAGGCGCAGAGTCGGGAGGG - Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1048841486 8:138570437-138570459 CTGGAGAGGCAGAGTGTGCTGGG - Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1050241935 9:3645735-3645757 ACAGAGAGAGAGAGTATGGATGG + Intergenic
1053474496 9:38372344-38372366 ACAGAGAGGCAGGGTGGGCACGG + Intergenic
1053522195 9:38791504-38791526 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054194422 9:62015968-62015990 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054643985 9:67572722-67572744 AGGGATAGGAAGTGTGTGGAGGG + Intergenic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055307252 9:74942733-74942755 AGGGAGAGGCACAATGTGCAAGG - Intergenic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056248435 9:84722228-84722250 ACGGGAAGGAAGAGTTTGGAAGG + Intronic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056757524 9:89391263-89391285 ACGGATAGCAAGAGTGTGCAAGG - Exonic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057866637 9:98686884-98686906 GGGGAGAGGCAGAGCTTGGAGGG - Intronic
1058322948 9:103657442-103657464 AAAGAGAGACAGAGTGTGAAGGG - Intergenic
1059038415 9:110785682-110785704 TCGGAGAGGGAGCGTTTGGAAGG + Exonic
1059321230 9:113471648-113471670 ACGGAGAGAGAGAGCGGGGAGGG - Intronic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1060032899 9:120231001-120231023 ACCCACAGGCACAGTGTGGATGG - Intergenic
1060403231 9:123360447-123360469 AAGGAGGGGCGGGGTGTGGAGGG - Intronic
1060629417 9:125143055-125143077 CCGGAGAGGCGGGGCGTGGAGGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1062512941 9:136917418-136917440 ACAGAGGGGCAGAGTCTGCAGGG - Intronic
1203726758 Un_GL000216v2:56069-56091 ATGGAGAGGAAGAGAATGGAAGG - Intergenic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1203681607 Un_KI270756v1:69037-69059 ACGGAAAGGAATAGAGTGGAAGG - Intergenic
1185874592 X:3692098-3692120 AGGGAGAGCGAGAGTGGGGAGGG + Intronic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186500401 X:10046084-10046106 CTGGAGAGGCTCAGTGTGGATGG + Intronic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189129760 X:38485542-38485564 GGGAAGAGGCAGAGTGCGGAGGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1196047036 X:111267293-111267315 TGGGTGAGGCAGAGTGTGGTGGG + Intronic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1198098980 X:133407378-133407400 ACAGAGAGGGAGAGTGAGGGAGG - Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1198710436 X:139495712-139495734 TGAGAGAGGCAGAGTGTGGTAGG - Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199586257 X:149420108-149420130 AGGGAGAGGCAGAGGGGAGAGGG - Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1201638594 Y:16153694-16153716 ACAAAGAGGCAGAGACTGGAAGG - Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1202037996 Y:20654799-20654821 AGGGAGTGTCACAGTGTGGAAGG + Intergenic