ID: 918388675

View in Genome Browser
Species Human (GRCh38)
Location 1:184036712-184036734
Sequence CAGGGCTAGCAGTATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918388668_918388675 -7 Left 918388668 1:184036696-184036718 CCCTATCCCCTCACGTCAGGGCT 0: 1
1: 0
2: 0
3: 4
4: 118
Right 918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 150
918388669_918388675 -8 Left 918388669 1:184036697-184036719 CCTATCCCCTCACGTCAGGGCTA 0: 1
1: 0
2: 1
3: 7
4: 90
Right 918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG 0: 1
1: 0
2: 2
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918388675 Original CRISPR CAGGGCTAGCAGTATGAGGT GGG Intronic
901762676 1:11480765-11480787 CAGGTGTAGTAGTAGGAGGTGGG - Intronic
901839097 1:11942803-11942825 CAGGGCTAGGGGTCTGAGGTGGG - Intronic
902513459 1:16978241-16978263 CAGGAATAGCAGGAAGAGGTAGG + Exonic
904597174 1:31654166-31654188 CAGGGCAAGGAGTATGGGGGTGG + Intronic
906351048 1:45059896-45059918 CAGGACTACCAGGTTGAGGTGGG + Intronic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
908359923 1:63358858-63358880 CAGGGCGAGAAGTGGGAGGTGGG + Intergenic
910081099 1:83342532-83342554 CAGGGGTAGTATTATGGGGTGGG + Intergenic
910300559 1:85702466-85702488 CTGGGATAGCTGTATGATGTTGG - Intronic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
911163574 1:94705853-94705875 AAGGGCTGGCAGTTTGAAGTGGG - Intergenic
912704589 1:111902505-111902527 CAGGGCTAGTAGAATCAAGTTGG - Intronic
917402954 1:174671809-174671831 CTGGTCTAGCAGAATGAGTTTGG + Intronic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
920183356 1:204146206-204146228 CAGGGCCCTCAGAATGAGGTGGG - Intronic
920391502 1:205606101-205606123 CAGGGTTGGCATTATCAGGTAGG - Intronic
922762324 1:228140730-228140752 CAAGGCTTGCAGGGTGAGGTGGG - Intronic
923013617 1:230108842-230108864 CTGGGCTAGCGATATGCGGTCGG - Intronic
923384377 1:233452086-233452108 CAAGGCCAGCAGACTGAGGTAGG + Intergenic
924044725 1:240015962-240015984 TAGGGCCAGGAGTAAGAGGTTGG - Intronic
1063631202 10:7735185-7735207 CAGGGCTGGGAGCAAGAGGTGGG - Intronic
1065059461 10:21883773-21883795 CTGGACTAGCAATATGCGGTAGG - Intronic
1067463268 10:46474123-46474145 CAGGGCCAGCTGTTTGGGGTGGG - Intergenic
1067623926 10:47910515-47910537 CAGGGCCAGCTGTTTGGGGTGGG + Intergenic
1072190760 10:93074610-93074632 GCGGGCTAGCAGCTTGAGGTGGG + Intronic
1073737304 10:106364141-106364163 CTGGGCTAGCAATATGTGGTAGG - Intergenic
1076161651 10:128248244-128248266 CAGGCCTTGCAGTATGGAGTAGG + Intergenic
1076978938 11:195199-195221 CAGAGGCAGCGGTATGAGGTGGG + Intronic
1077506899 11:2933765-2933787 ATGGCCTAGCAGTATGTGGTTGG - Intergenic
1077601135 11:3575732-3575754 CAGGGCTGGCAGTGTCAGGCAGG - Intergenic
1079724827 11:23867780-23867802 TAGGGCCAGCAGACTGAGGTGGG - Intergenic
1080031003 11:27661175-27661197 CAGGGCTTGCAATGTGGGGTTGG - Intronic
1082004888 11:47414022-47414044 CAGGGGGAACAGTGTGAGGTGGG - Intronic
1082252978 11:50002245-50002267 CAAGGCTAGCAGTTAGAGGCAGG - Intergenic
1082270000 11:50160156-50160178 CAGGGCTGGGAGTGTGTGGTGGG + Intergenic
1084661486 11:70549019-70549041 GGGGGCTAGCAGTCTGAAGTCGG - Intronic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1089564088 11:119361715-119361737 CAGGGCTAGCACTAACAGGTAGG + Intronic
1089565150 11:119367336-119367358 TAGGGCTAGCTCTATGAGGGCGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1091553559 12:1554790-1554812 CAGGGGTTGCAGTCTGAGTTTGG + Intronic
1092952609 12:13521295-13521317 CAGGGCTGGGAGTAGGAGATGGG + Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095307269 12:40652871-40652893 CTGGGCTAGAAGTATAAGTTTGG - Intergenic
1096759836 12:53831995-53832017 CAGGGCCTGCAGTATGAGCTGGG - Intergenic
1097267317 12:57753836-57753858 CAGGGCTACAAGTATCAGGATGG - Intronic
1097728461 12:63100791-63100813 CAGGGCCAGCAGATTGAGTTGGG + Intergenic
1098040337 12:66348159-66348181 CATGTCAAGCAGTATGAGTTTGG + Exonic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1102352381 12:112203428-112203450 CAGGGCTGGCAGTAGATGGTAGG - Intronic
1102634188 12:114308426-114308448 AAGGGCTTGAAGGATGAGGTGGG - Intergenic
1105790583 13:23794376-23794398 CAGCGTTAGCAATATGAGGAAGG - Intronic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1109941610 13:69374794-69374816 CAAGGCAATCAGTATGAAGTGGG + Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1112375632 13:98837655-98837677 CAAGGCTGGCAGGATGCGGTAGG + Intronic
1113443496 13:110347640-110347662 CAGGGCATGCAGTGTGTGGTGGG - Intronic
1114326403 14:21593548-21593570 CAGTGCTAGGAGGCTGAGGTGGG + Intergenic
1115052625 14:29082515-29082537 CAAAGCTGGCAGTATGAGATGGG + Intergenic
1115081388 14:29455424-29455446 CAGGGCTAGCTTTATAAGATTGG - Intergenic
1116386041 14:44331192-44331214 CTGGGCCAGCAATATGTGGTAGG - Intergenic
1117400534 14:55355046-55355068 AAGGGCTTGAAGTAGGAGGTAGG - Intronic
1118474639 14:66105232-66105254 AAGGGCTAGAAGAATGATGTAGG + Intergenic
1119464806 14:74848439-74848461 CAGTGCTAGGAGGCTGAGGTGGG + Intronic
1121121253 14:91377129-91377151 CAGGGCAGGCAGTCTGAGGTGGG - Intronic
1121782008 14:96627991-96628013 CAGGCCTAGCAGGAAGAAGTGGG + Intergenic
1127127772 15:55830124-55830146 CAGGGGTAGAAGTAAGACGTAGG + Intronic
1128373619 15:67059491-67059513 CTGGGCTAGCAGTAAGGGGCTGG + Intergenic
1128784765 15:70386710-70386732 CAAGGCTGGCAGTATGGGGGAGG + Intergenic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1142715726 17:1745853-1745875 CAGGGGTGACAGGATGAGGTTGG - Exonic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143587683 17:7858732-7858754 CAGGGGTCGTATTATGAGGTGGG + Exonic
1148147763 17:45376786-45376808 CAGGGCCAGGAGTGAGAGGTGGG - Intergenic
1150223132 17:63508262-63508284 CAGGGCTGGCAGGATGCCGTGGG + Intronic
1155804337 18:30146886-30146908 CATGGCTAGAAGTATCATGTGGG + Intergenic
1158139437 18:54241637-54241659 CAAGTCTAGCTGAATGAGGTGGG + Intergenic
1159199061 18:65159960-65159982 GAGGTTTGGCAGTATGAGGTGGG + Intergenic
1161379263 19:3956021-3956043 AAGGGCTGGGAGTATGAGTTTGG + Intergenic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1166423833 19:42658349-42658371 CACAGCTAGCAGGATGAGGATGG - Intronic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
927253415 2:21018659-21018681 GAGGGCTAGGAGTAGGAGGGAGG - Intronic
932334306 2:70921214-70921236 CAGCGCTGCCAGTATGTGGTGGG + Exonic
932708595 2:74046478-74046500 CCAGGCGAGCAGTATGAGCTGGG - Exonic
937577733 2:123444509-123444531 CAAGGCCAGCAGACTGAGGTGGG + Intergenic
937870597 2:126783271-126783293 CAGAGCTGGCAGTATGAGTTGGG + Intergenic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
944890983 2:204117215-204117237 CAGTGCTAGCATGGTGAGGTTGG + Intergenic
945333684 2:208567244-208567266 CAGGGCCAGCAGACTCAGGTGGG - Intronic
946560035 2:220902230-220902252 CAGGGCTAGCAATAAGAGTAAGG + Intergenic
947486004 2:230549600-230549622 CACAGCTGGCAGTCTGAGGTGGG + Intergenic
948532502 2:238618833-238618855 CAGAGCTAGCAGTGGGTGGTGGG + Intergenic
1169203901 20:3729672-3729694 CAGTGCTAACAGGCTGAGGTGGG + Intergenic
1169522342 20:6387287-6387309 CAGGGCCAGTAGACTGAGGTGGG - Intergenic
1170096098 20:12647508-12647530 CCAGGCTAGCAATATGGGGTAGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172011149 20:31846632-31846654 CAGAGCTAGGAGGATGGGGTAGG - Intergenic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1180868551 22:19133456-19133478 CAGGGCCAGCAGCATAAGATGGG + Exonic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1184286738 22:43476252-43476274 CAGTGCTGGCAGGGTGAGGTGGG + Intronic
1185267583 22:49912353-49912375 CAGGGTTGGCAGCAAGAGGTTGG - Intronic
954304417 3:49717900-49717922 CAGGGCGAGCAGCAAGAGGGTGG + Exonic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
961516253 3:127439193-127439215 CAGAGCTGGCAGTGAGAGGTGGG + Intergenic
965143138 3:164864832-164864854 CAGGGCCAGCTGAATGAGGTGGG - Intergenic
967278072 3:187795863-187795885 CCGGGCCAGCAGAATGATGTTGG - Intergenic
968270467 3:197399528-197399550 CAGGGGTAGCAGTTGGGGGTTGG - Intergenic
968652399 4:1765451-1765473 CAGGGGTGGCAGTGTGAAGTGGG - Intergenic
970147757 4:13054732-13054754 CAGGGCAAGAAGAATGAGTTTGG - Intergenic
974639788 4:64613291-64613313 CAAGGATTGCAGCATGAGGTAGG + Intergenic
976318523 4:83685405-83685427 AAGGGATGGCATTATGAGGTGGG - Intergenic
976783302 4:88786254-88786276 GAGGGCTAGCAGGTGGAGGTGGG - Intronic
979334567 4:119449270-119449292 CAGGGGTACCAGGATTAGGTTGG - Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985390458 4:189487220-189487242 CTGGGCTAGCAGCATGTGGTAGG + Intergenic
987034420 5:14005880-14005902 CAGGGCTGGCAGAATGAAGGAGG + Intergenic
987300500 5:16593319-16593341 CAGAGCTTGTAGTATGGGGTAGG - Intronic
987754026 5:22076946-22076968 TAGGGATTGCACTATGAGGTTGG + Intronic
988125271 5:27024845-27024867 TAGGGCTAGTAGTTTGAGCTGGG + Intronic
988817341 5:34847508-34847530 CAGGGCTAGGAGTACTAGGTTGG - Intronic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
991959664 5:72031654-72031676 CAGGGTTAGCAATATGAGCAAGG - Intergenic
992357438 5:76000440-76000462 CAGGCCCAGCATTATGAGGCAGG - Intergenic
998970400 5:147585031-147585053 CAGGGCTATCAGTGTAATGTAGG - Intergenic
1004798784 6:19120883-19120905 CGAGGCTAGCAGACTGAGGTAGG - Intergenic
1006107634 6:31726140-31726162 CAAGGGTAGGAGGATGAGGTGGG - Intronic
1014156130 6:118111888-118111910 GAGGGCTAGGAATATGAGGCTGG + Intronic
1016629385 6:146210579-146210601 CAGGGATAGGAGTTTGAGGTAGG + Intronic
1021933875 7:25610193-25610215 CATGGCTAGCAGTTGGAGGGAGG + Intergenic
1023865175 7:44235033-44235055 CAGGACTAGCTGTGTCAGGTTGG + Intronic
1024069490 7:45774409-45774431 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1027298574 7:76804793-76804815 CAGGGGTAGTATTATGGGGTGGG + Intergenic
1032046881 7:128618713-128618735 CAGGGGTACCAGGATTAGGTTGG + Intergenic
1033942153 7:146668503-146668525 CTGGGCTTGCAGAATGAGTTTGG + Intronic
1036556056 8:9861610-9861632 CATGGTTAGCAGGATGAAGTGGG + Intergenic
1037940836 8:22949574-22949596 CTGGGCTAGCAGTATGTGGTAGG + Intronic
1041137677 8:54778011-54778033 CATGGCTACCTGTATGAGGAAGG - Intergenic
1044727874 8:95207932-95207954 CAGGGCCAGCAGGATGGGCTGGG - Intergenic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1048187534 8:132255394-132255416 CTGAGCTAGCAATATGAGTTGGG + Intronic
1048926896 8:139279440-139279462 CAGGGGTAGGGGTATGAGGTGGG + Intergenic
1052829626 9:33204230-33204252 CAGGGCAAGCAGTATCACTTAGG + Intergenic
1053029320 9:34760659-34760681 CAGGACTAGGAGTATTGGGTGGG - Intergenic
1053297603 9:36925906-36925928 CGGGGCCAGCAGAATGAGGGTGG - Intronic
1058058084 9:100469212-100469234 CAGGGCTGGGAGTATGGGATGGG + Intronic
1059416960 9:114168340-114168362 CAGGCCTAGCAGGGCGAGGTCGG - Exonic
1060200036 9:121646864-121646886 CAGGGCTTGCACTAGGAGGCAGG - Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186180289 X:6967220-6967242 CAGGTCTAGCAGCATGGGGGAGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1187717907 X:22121886-22121908 CAGATGTAGCAGTATGGGGTGGG - Intronic
1193223585 X:78955697-78955719 CAGGGCTCACAGACTGAGGTGGG - Intronic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1196604093 X:117636027-117636049 CCAGGCTAGCAGTATGAGGTTGG - Intergenic
1196939947 X:120765672-120765694 TAGGGATAGCAGAAAGAGGTTGG + Intergenic
1197960336 X:131998047-131998069 CTGGGCTAGCAATATGTAGTAGG + Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1199762335 X:150914626-150914648 TAGGGCTAGCGGGAGGAGGTTGG + Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201747474 Y:17394325-17394347 CTGGGCTAGCAATATGTAGTAGG + Intergenic