ID: 918388852

View in Genome Browser
Species Human (GRCh38)
Location 1:184037415-184037437
Sequence CTGAGGGCGGCGGCGGCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 18, 3: 87, 4: 690}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918388846_918388852 -9 Left 918388846 1:184037401-184037423 CCCGGCTGGGCTGCCTGAGGGCG 0: 1
1: 0
2: 1
3: 44
4: 401
Right 918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG 0: 1
1: 0
2: 18
3: 87
4: 690
918388838_918388852 26 Left 918388838 1:184037366-184037388 CCGAGGCGGGCGGCGGGGAAGTC 0: 1
1: 0
2: 0
3: 23
4: 1461
Right 918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG 0: 1
1: 0
2: 18
3: 87
4: 690
918388842_918388852 4 Left 918388842 1:184037388-184037410 CCTGGCGCGAGCGCCCGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG 0: 1
1: 0
2: 18
3: 87
4: 690
918388847_918388852 -10 Left 918388847 1:184037402-184037424 CCGGCTGGGCTGCCTGAGGGCGG 0: 1
1: 0
2: 2
3: 31
4: 336
Right 918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG 0: 1
1: 0
2: 18
3: 87
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918388852 Original CRISPR CTGAGGGCGGCGGCGGCTGC CGG Exonic
900221646 1:1512354-1512376 CCGAGGGCGGCGGGGACCGCGGG + Exonic
900319199 1:2074225-2074247 CTGAGCGAGGCAGGGGCTGCTGG + Intronic
900713105 1:4127517-4127539 GTGAGGGCGGCCGGGGCTCCTGG + Intergenic
900754630 1:4425034-4425056 CTGAGGGTGGCGCAGGCTGAGGG + Intergenic
901302957 1:8212842-8212864 CTGAGCCCGGCGGGGGCTGCTGG + Intergenic
901332748 1:8423674-8423696 CGCAGGGCGGAGGCGGCCGCGGG + Intronic
901633062 1:10657252-10657274 CTGGCGGTGGCGGCGGCGGCTGG - Intronic
902374663 1:16024712-16024734 CTGAGGGCTGCAGAGGCTGTGGG + Intronic
902626141 1:17677538-17677560 ATGAGGGCAGGGGCTGCTGCTGG - Intronic
902768058 1:18630108-18630130 CTGAGGAGGACGGCGGCGGCTGG + Intergenic
902823237 1:18956231-18956253 GCGGGGGCGGCGGCGGCGGCGGG - Exonic
903055494 1:20633504-20633526 GTGGCGGCAGCGGCGGCTGCGGG + Exonic
903105265 1:21072851-21072873 CTGATGGTGGCAGCAGCTGCTGG + Intronic
903462701 1:23530625-23530647 CTGCGGGAGGCGCCGTCTGCGGG + Exonic
903647733 1:24905021-24905043 TTGTGGGCGGCTGCGGCTGGGGG + Intronic
903777091 1:25800206-25800228 CTGCGGCTGGCGGCGGCTGCCGG - Exonic
903907388 1:26696448-26696470 CCGAGGGCGGCGGCGGCGGCGGG - Exonic
903950635 1:26994098-26994120 CGAAGCACGGCGGCGGCTGCTGG + Exonic
904006653 1:27366547-27366569 CGGAGCGCGCCGGCAGCTGCTGG - Exonic
904273815 1:29367469-29367491 CTGAGGGTGGCGTGTGCTGCGGG - Intergenic
905107703 1:35574076-35574098 CGTAGGGCAGCGGTGGCTGCGGG - Exonic
905137094 1:35808255-35808277 CAGGGGGCGGCGGCGGCGCCCGG - Exonic
905372598 1:37492169-37492191 CTGAGCGTGGTGGCGGGTGCCGG - Intergenic
905752365 1:40477261-40477283 CTGTGGGCGGAGCCGGCGGCCGG + Exonic
906027023 1:42682605-42682627 CTGAGGGCGGGGGCGGCGGGGGG - Exonic
906069609 1:43007516-43007538 GGGAGGGCAGCGGGGGCTGCTGG - Intergenic
906325523 1:44843161-44843183 CCGTGGGCCGCGGCGGCTGGAGG + Intergenic
906640563 1:47438397-47438419 CGGGGGGCGGCGGCCGCAGCGGG + Exonic
906877722 1:49556964-49556986 CTGGGGCCGGCGGTGCCTGCCGG + Intronic
907297483 1:53464675-53464697 GTGGCGGCGGCGGCGGCGGCAGG - Exonic
907341231 1:53737927-53737949 CCGTGAGTGGCGGCGGCTGCGGG - Intergenic
907444568 1:54499522-54499544 CGCCGAGCGGCGGCGGCTGCCGG + Intergenic
907496714 1:54850188-54850210 CTAAGGGCGACAGAGGCTGCTGG + Exonic
908132171 1:61083757-61083779 GTGGTGGCGGCGGCGGCGGCGGG - Intronic
910338226 1:86156686-86156708 CTCGGGGCGCCGGCGGCAGCGGG + Exonic
910596982 1:88991804-88991826 CTGAGGGGGACTGGGGCTGCAGG - Intronic
910758879 1:90716901-90716923 CGGCCGGCGGCGGCGGCTGCTGG + Exonic
911498830 1:98661690-98661712 CTGGCGGCGGCGGTGGCGGCCGG + Intronic
911647609 1:100352795-100352817 CCGAAGGCGGAGGCGGCTTCGGG - Exonic
913248318 1:116889947-116889969 CTGAGGGACGCTGCTGCTGCTGG + Intergenic
914258225 1:145977590-145977612 CTGAGGGCCGAGGCTGCTGCTGG + Intronic
915517186 1:156420468-156420490 GTGCTGGCGGCGGCGGCGGCCGG - Intronic
916065503 1:161132633-161132655 GCGGCGGCGGCGGCGGCTGCTGG - Exonic
916140596 1:161693672-161693694 CTGAGGGAAGGGGCGGCTGTGGG + Intergenic
917262851 1:173188787-173188809 CCCAGGGAGGCGGAGGCTGCAGG - Intronic
917846675 1:179025968-179025990 GTGGCGGCGGCGGCGGCTGGGGG + Exonic
918260308 1:182789748-182789770 TAAAGCGCGGCGGCGGCTGCCGG + Intronic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
918265675 1:182839551-182839573 CGGGCGGCGGCGGCGGCTGGGGG + Intronic
918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG + Exonic
919872039 1:201829210-201829232 ATGGCGGCGGCGGCGGCAGCTGG + Exonic
919976948 1:202619053-202619075 CTGGAGGCGGAGGAGGCTGCTGG - Intronic
921603989 1:217135546-217135568 GTGTTGGCGGCGGCGGCGGCAGG + Intronic
922573943 1:226650143-226650165 CAGGGGTCAGCGGCGGCTGCTGG + Intronic
922766068 1:228157295-228157317 CTGAGGGCTGATGGGGCTGCAGG + Intronic
924052424 1:240092264-240092286 GAGGGGGCGGCGGCGGCGGCGGG + Exonic
924289723 1:242524714-242524736 CCCGGGGCGGCGGCGGCGGCGGG + Intergenic
924436682 1:244048904-244048926 CCGGCGGCGGCGGCGGCGGCCGG + Intergenic
1062932608 10:1363005-1363027 GTGAGGGGCGCGGCGGGTGCAGG - Intronic
1062947923 10:1474932-1474954 GTGACCGAGGCGGCGGCTGCCGG + Intronic
1064086284 10:12349029-12349051 CGACGGGCGGCGGCGGCGGCTGG - Intergenic
1064185498 10:13158544-13158566 GAGAGGGCGGCGGCGGCGGTGGG - Intergenic
1064209079 10:13348112-13348134 CCGGCGGCGGCGGCGGCGGCGGG + Exonic
1064662176 10:17617308-17617330 CTGACGGAAGCGGCGGCAGCGGG - Exonic
1064981873 10:21173851-21173873 GCGGCGGCGGCGGCGGCTGCTGG + Intronic
1065021164 10:21502491-21502513 CTGAAGGAGGAGGCAGCTGCAGG + Intergenic
1065023158 10:21517134-21517156 GCGGCGGCGGCGGCGGCTGCCGG + Exonic
1065099099 10:22316303-22316325 CTGGCGGCGGCGCGGGCTGCGGG - Exonic
1065140472 10:22714453-22714475 CTGAGCGCGCCGGCGGCGGCGGG - Exonic
1065520570 10:26567284-26567306 CGGGCGGCGGCGGCGGCGGCGGG - Exonic
1065687633 10:28302573-28302595 CTCCGGGCGGGGGCGGCGGCGGG - Intronic
1065989085 10:30990426-30990448 CTGAGTGAGGCTGAGGCTGCTGG - Intronic
1066180736 10:32958372-32958394 GAGAGGGCGGCGGCGGCCTCGGG - Intronic
1066464553 10:35640910-35640932 CGCCGGGCGGCGGCGGCGGCAGG + Exonic
1067015583 10:42754784-42754806 CCGAGAGCGCCGGCGGCTGGGGG - Intergenic
1067416419 10:46106444-46106466 CAGAGGGCGGCGGCGAGAGCTGG + Intergenic
1067570156 10:47365690-47365712 CTGAGAGAGGCAGAGGCTGCAGG + Exonic
1067694199 10:48523726-48523748 CTGGCCGCGGCGCCGGCTGCAGG - Intronic
1069997958 10:72354622-72354644 CTGAGGCGCGCGGTGGCTGCTGG - Intronic
1070032620 10:72692210-72692232 GCGGGGGCGCCGGCGGCTGCGGG + Exonic
1070213225 10:74347961-74347983 CTGAGGGAAGGGGCGGCTGTGGG + Intronic
1070327693 10:75399224-75399246 CTAACGGCCGCCGCGGCTGCTGG - Exonic
1070752706 10:78973588-78973610 CCGAGGTGGGCGGCGGCTGCTGG - Intergenic
1070800808 10:79243454-79243476 CGGACGGCGGCGGCGGTGGCGGG + Intronic
1072102212 10:92239840-92239862 GCGCAGGCGGCGGCGGCTGCTGG + Exonic
1072409070 10:95183876-95183898 CCCGGGGCGGCGGCGGCGGCAGG - Intergenic
1072719461 10:97771811-97771833 ATGCGGGCGGCGGCGGCGGGGGG - Exonic
1072810688 10:98459175-98459197 CTGAGGGCAGCAGCAGCAGCAGG + Exonic
1072881363 10:99232729-99232751 CTGCGGGAGGGGGCCGCTGCGGG - Intronic
1073058259 10:100715701-100715723 CAGACGGCGCCGGCGGCGGCTGG - Intergenic
1073452212 10:103616725-103616747 CTGGGGGCGGGGGCGGGTGCAGG - Intronic
1073485169 10:103812677-103812699 CTGTGTGTGGAGGCGGCTGCTGG - Intronic
1074377319 10:112951029-112951051 CTGGGGGCGGCGGCGGGGCCCGG + Intronic
1074864095 10:117535046-117535068 CCGGGGGCGGGGGCAGCTGCGGG + Intergenic
1074881262 10:117661325-117661347 CTGTGGGCTGTGGCGGCTGCAGG + Intergenic
1075032095 10:119030300-119030322 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1075656855 10:124167768-124167790 CTGAGGGAGGGGGAGGGTGCAGG + Intergenic
1075701963 10:124475741-124475763 CTGAGGGCCATGGTGGCTGCAGG - Intronic
1075746751 10:124733325-124733347 CTGAGGGCGGTGGAGGCCTCAGG + Intronic
1075748522 10:124744344-124744366 CGGCGTGCGGCGGCGGCGGCAGG + Intronic
1076020204 10:127066204-127066226 CTGGGGGCGGCGGGGGCACCTGG - Intronic
1076356682 10:129858404-129858426 CTGAGGGTGGCGGCTCCTCCAGG - Intronic
1076374056 10:129971896-129971918 GCGAGGGCGGCGGCGGCGGGAGG - Intergenic
1076374265 10:129972943-129972965 GTGTCGGCGGCGCCGGCTGCGGG + Intergenic
1076554151 10:131311350-131311372 CAGAGGGCAGCGGCAGCAGCGGG + Exonic
1076625384 10:131818636-131818658 CGGAGGGCGGCGGGGTCTCCTGG - Intergenic
1076717517 10:132374039-132374061 ATGGGGGCGGGGGAGGCTGCAGG + Intronic
1076785786 10:132749258-132749280 CTGTGGGCGGCAGCAGCTCCGGG + Intronic
1076916849 10:133427278-133427300 CTGAGGGTGTCGGGGGCTCCTGG + Intergenic
1076930617 10:133529337-133529359 CTCAGCGAGGCGGCGGCTGCCGG + Intronic
1076936952 10:133572078-133572100 CTGAGGGTGTCGGGGGCTCCTGG + Intergenic
1077056379 11:595881-595903 CAGAGGGGGGCGGCGGGTGGGGG - Intronic
1077085253 11:747044-747066 CTGGGGTCGGGGGCCGCTGCAGG - Intergenic
1077087770 11:763226-763248 GTGAGGGCGGGGGCGGGTGAGGG - Intronic
1077087791 11:763273-763295 GTGAGGGCGGGGGCGGGTGAGGG - Intronic
1077637892 11:3855779-3855801 CTGAGGGCGCGGGCGTCTCCGGG - Exonic
1078331438 11:10425683-10425705 CTGGGGGAAGCGGCGGCTGTGGG - Intronic
1079237103 11:18698866-18698888 ATGGCGGCGGCGGCGGCGGCTGG - Exonic
1081700038 11:45146986-45147008 CTGGGGGCGGGGGCGGCCGGGGG + Intronic
1081801084 11:45859806-45859828 TGGGGAGCGGCGGCGGCTGCTGG - Intronic
1081807902 11:45900160-45900182 CTGCGGGCGGCGGCGGCGCGGGG + Exonic
1081812889 11:45923137-45923159 TGGGCGGCGGCGGCGGCTGCGGG - Exonic
1081831911 11:46121540-46121562 CGCACGGCGGCGGCGGCGGCGGG - Intergenic
1082083369 11:48029102-48029124 CTGAGGGCTGCAGATGCTGCCGG + Intronic
1083170747 11:60922739-60922761 CTGAGGCCTGTGGGGGCTGCAGG + Exonic
1083272966 11:61581235-61581257 CTTCGGGCGGCGGCGGGCGCGGG - Intergenic
1083428794 11:62602967-62602989 CAGTGGGTGGCCGCGGCTGCCGG - Intronic
1083477665 11:62924511-62924533 CTGAGGGGGGCGGAGGCGGGCGG - Intergenic
1083753715 11:64778131-64778153 GTGGAGGCGGCGGCGGCTGCTGG + Exonic
1083763791 11:64832728-64832750 CTGAGGGCCGCGGCACCTGGCGG + Exonic
1083852830 11:65377948-65377970 CTGATGGCGACGGGGGCTGGCGG + Intronic
1084063961 11:66692920-66692942 CTGGGGGTGGAGCCGGCTGCAGG - Intronic
1084118800 11:67056967-67056989 TGGTGGGCGACGGCGGCTGCGGG + Exonic
1084146145 11:67266408-67266430 CCGGAGGCGGCGGCGGCTCCGGG + Exonic
1084178408 11:67435070-67435092 TCGAGGGCGGCGGCGGTGGCAGG - Exonic
1084284163 11:68120940-68120962 CTGCGGGCGGCTGCGGCGGCGGG + Exonic
1084295909 11:68213380-68213402 GCGACGGCGGCGGCGGCGGCCGG - Exonic
1084296187 11:68214334-68214356 CTGGGGGCGGCGGGGCCCGCGGG - Intergenic
1084546850 11:69818951-69818973 CCCGCGGCGGCGGCGGCTGCAGG + Exonic
1084672734 11:70616687-70616709 CTGAGGCCTCCGGAGGCTGCTGG + Intronic
1085174022 11:74471201-74471223 CTGAGGGCAGCGGGAGCTGTGGG - Intergenic
1085176617 11:74493610-74493632 CCGCTGGCTGCGGCGGCTGCAGG - Exonic
1085284627 11:75351727-75351749 GCGGGGGCGGCGGCGGCGGCCGG - Intergenic
1085353420 11:75815345-75815367 AAGGGGGCGGCGGCGGATGCCGG + Exonic
1085784873 11:79440277-79440299 CCGGGGGCTGCGGCGGCTCCAGG + Intronic
1086993398 11:93330510-93330532 ATGGGCGCGGCGGCGGCGGCAGG - Intronic
1088595407 11:111437122-111437144 CTGAGGGTGGGGGCTGCTGGGGG - Intronic
1089078878 11:115760158-115760180 TGCAGGGCGGCGGCGGCGGCCGG + Intergenic
1089432654 11:118436559-118436581 CCGGGGGCGGCGGCGGCGGGGGG + Exonic
1089494985 11:118903298-118903320 CTGGGGGCGGGGGCGGGGGCGGG - Exonic
1089511139 11:118998087-118998109 CTGAGGGCCGCGGGAGCCGCCGG + Intergenic
1089543715 11:119206449-119206471 CCGGGGGCGGCAGCGGCTCCGGG + Exonic
1089545209 11:119219132-119219154 CTGAGGGAGGCTGAGGCTGGTGG + Intronic
1089778334 11:120855155-120855177 CTAGGGGCGGCTGAGGCTGCTGG + Intronic
1090345617 11:126067435-126067457 CTCAGGGCGGCAGTGGCGGCAGG - Intergenic
1091201971 11:133787938-133787960 CTGAGGGGAGCGACTGCTGCAGG + Intergenic
1091225742 11:133955901-133955923 CTGGGGGCGGCGGCGGGGGAGGG - Intronic
1091248905 11:134125066-134125088 CACAGGGCAGCGGCGGCTGCAGG - Intronic
1091335434 11:134762566-134762588 CTGAGGATGGCGGCAGCCGCGGG + Intergenic
1091396417 12:156444-156466 CTGAGGGCTGGGGCAGCTGGGGG + Intronic
1091854822 12:3731173-3731195 CTGGAGGTGGCGGAGGCTGCTGG - Intronic
1092318059 12:7440319-7440341 CGGTGGGCGGCGGCGGCTCCAGG - Intronic
1095432043 12:42144750-42144772 AAGGCGGCGGCGGCGGCTGCGGG - Exonic
1095945168 12:47749566-47749588 CTGGGGGCGGCAGGGGCGGCAGG - Intronic
1096101013 12:48970493-48970515 CCGAGGGCGGAGGCCGCGGCCGG + Exonic
1096336944 12:50764057-50764079 CTGGGGGCGGGGGCGGGGGCGGG - Intronic
1096372856 12:51083383-51083405 GCTAGGGCGGCGGCGGCAGCGGG - Exonic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1098550371 12:71755137-71755159 CGGCCGGCGGCGGCGGCGGCGGG + Exonic
1100632289 12:96400591-96400613 CTGCCGGCGGCGGCGGAGGCGGG + Intergenic
1101574188 12:105982421-105982443 CTGAAGGCGGAGGCAGCTACTGG + Intergenic
1102220877 12:111193681-111193703 GTGGGGGCTGCGGGGGCTGCCGG + Intronic
1102457138 12:113077854-113077876 GTGGCGGCGGCGGCGGCAGCGGG - Exonic
1102470826 12:113158946-113158968 CTGGACGCGGCGGCGGTTGCGGG + Exonic
1102471398 12:113161796-113161818 CTGGGGGCGGGGGCGGGGGCGGG - Intronic
1102561564 12:113766180-113766202 CTGGGGGCGGCCGCGGGGGCCGG - Intergenic
1103309099 12:119989977-119989999 ATGAGGGCGGCGGCGGCGGCGGG - Exonic
1103433067 12:120904247-120904269 CGGGCGGCGGCGGCGGCGGCCGG + Exonic
1103853257 12:123946969-123946991 CTGCGTGCGGCGGCGCTTGCAGG + Intronic
1103899302 12:124295205-124295227 CGGAGGGCGGCGGCGCTGGCAGG + Intronic
1104983382 12:132583608-132583630 CCGAGGGCGGCGGCGGCGGGCGG - Exonic
1105280335 13:18959425-18959447 CTGAGGGAGGTGGTGGCTGCAGG + Intergenic
1105323116 13:19346182-19346204 CTGCGGGCTGCTGCGGGTGCTGG + Intergenic
1105349360 13:19601933-19601955 CGGTGGGCTGCGGCGGCTCCAGG + Intergenic
1105472070 13:20703736-20703758 CTCGGGGCGGCGGCGGCGGCGGG + Intronic
1105625164 13:22105880-22105902 CTCAGGGCATAGGCGGCTGCAGG + Intergenic
1106220774 13:27744578-27744600 CTGATGGTGGTGCCGGCTGCTGG + Intergenic
1106478030 13:30114804-30114826 CGGGAGGCGGCGGCGGCGGCGGG + Intergenic
1106776720 13:33016467-33016489 GCGACGGCGGCGGCGGCCGCGGG - Exonic
1107058499 13:36131189-36131211 CTGGGCGCGGCCGGGGCTGCGGG + Exonic
1107481469 13:40789429-40789451 CGGTGGGCGGTGGCGGCTCCCGG + Intronic
1107851414 13:44576561-44576583 CTGGCGGCGGCGGCGGCCCCGGG - Exonic
1108292556 13:48976057-48976079 CTCAGGGCCGCCGCGGCCGCCGG - Intronic
1109638104 13:65149836-65149858 CTGGGGCCGGCGGCGCCAGCTGG + Intergenic
1110318200 13:74134286-74134308 CCGAGGGCGGGGGCGGCGGCGGG + Intergenic
1110558512 13:76886258-76886280 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1110573050 13:77026868-77026890 CCGGGGACGGCGGCGGCTGCAGG + Exonic
1112077771 13:95931709-95931731 CTCAGGCCGGCGGGCGCTGCCGG - Intronic
1112282700 13:98076555-98076577 CTGGGGCCGGCGGGGCCTGCCGG + Intergenic
1113506510 13:110820801-110820823 CTGAGGGTGGTGGCTCCTGCAGG + Intergenic
1113541772 13:111115146-111115168 CGCGGGGCGGCGGCGGCGGCTGG - Intronic
1113655927 13:112067762-112067784 GCGGGGGCGGCGGCGGCGGCGGG + Exonic
1113765898 13:112881134-112881156 CAGGGGGCAGCGGCGGATGCTGG - Intronic
1113854838 13:113437443-113437465 CAGAGGGCACCGGCGGCTTCAGG - Intronic
1113968157 13:114166483-114166505 CAGAGGGCAGCTGAGGCTGCAGG - Intergenic
1113976963 13:114234973-114234995 GGGGCGGCGGCGGCGGCTGCAGG + Exonic
1115855093 14:37622371-37622393 CTGGGTGAGGCGGCGGCTCCAGG + Intronic
1117220851 14:53604058-53604080 GAGAGGGCAGCGGCTGCTGCAGG - Intergenic
1117779238 14:59215522-59215544 CTGCAGGCGGCAGCCGCTGCAGG + Intronic
1117941592 14:60972465-60972487 ATGGCGGCGGCGGCGGCGGCGGG + Exonic
1118152517 14:63204889-63204911 CTGACAGCAGCTGCGGCTGCAGG + Exonic
1118463908 14:66013740-66013762 CTGAGGGCGGGGGCGGCGGGCGG + Intergenic
1119410341 14:74426248-74426270 GAGAGGGAGGCGGCGGCGGCGGG - Intergenic
1119562097 14:75598717-75598739 CTGTGGGAGGCGGAGGCAGCAGG - Intronic
1120787468 14:88550547-88550569 TTAATGGCGGCAGCGGCTGCTGG - Exonic
1120843112 14:89104417-89104439 CTGAGGGAAGGGGCGGCTGTGGG - Intergenic
1120904667 14:89609893-89609915 GCGGGGGCGGCGGCGGCTGGCGG + Intronic
1121279389 14:92688188-92688210 GTGGTGGCGGCGGCGGCGGCGGG + Exonic
1121415906 14:93779209-93779231 GTGGGGGCGGCGGGGGCAGCGGG + Exonic
1122449370 14:101792952-101792974 ATGTGGGAGGCGGAGGCTGCAGG - Intronic
1122523423 14:102363035-102363057 CTCCGGGCCGCGGGGGCTGCCGG - Exonic
1122610012 14:102975860-102975882 GTGAGGGCAGCGCCGGCTCCGGG - Intronic
1122635335 14:103127079-103127101 CTGGCGGCGGCGGCGGCGGCGGG + Exonic
1122817766 14:104321936-104321958 CTGGGGGCGGGGGCGGCTGGAGG + Intergenic
1122921749 14:104883156-104883178 CGGGGGGCTGCGACGGCTGCGGG - Exonic
1122970749 14:105151220-105151242 ATGCGGGCTGCGGGGGCTGCTGG - Intronic
1122984185 14:105204773-105204795 CTGAGGGCCACGTGGGCTGCTGG - Intergenic
1123898062 15:24848230-24848252 GTGGGGGCGGGGGCGGCGGCGGG + Intronic
1124439354 15:29675268-29675290 CTGAGCGTGGCAGCTGCTGCCGG + Intergenic
1124492608 15:30167437-30167459 CTGGAGGCGGAGGAGGCTGCTGG - Intergenic
1124629004 15:31326728-31326750 TTACAGGCGGCGGCGGCTGCGGG - Intergenic
1124750926 15:32370888-32370910 CTGGAGGCGGAGGAGGCTGCTGG + Intergenic
1124789912 15:32717907-32717929 CTGGCGGCGGCGGCGGCGCCTGG + Intergenic
1124983354 15:34583559-34583581 CGGACGGAGCCGGCGGCTGCGGG - Intronic
1125516368 15:40323543-40323565 CGAGGGGAGGCGGCGGCTGCCGG - Intergenic
1125685044 15:41559071-41559093 CTGACGGCGGCGACCGCGGCCGG + Exonic
1127264024 15:57346792-57346814 CTGAGGGCGGCTGGTGCTGGGGG + Intergenic
1127855848 15:62953193-62953215 CGGGGGCGGGCGGCGGCTGCTGG - Intergenic
1127855849 15:62953200-62953222 CTGAGGGCGGGGGCGGGCGGCGG - Intergenic
1128455079 15:67827565-67827587 GTGCGGGCGGCGGGGGCGGCGGG - Intronic
1128546328 15:68570880-68570902 CTGTGGGCGGCTGAGGCTGGAGG - Intergenic
1129341588 15:74890012-74890034 CAGAGGGCCGCGGGGGCTGCCGG + Exonic
1129986461 15:79923497-79923519 CCGCGGGCGGCGGAGGCAGCGGG - Exonic
1130257381 15:82332090-82332112 CTGAGAGCAGCTGGGGCTGCAGG - Intergenic
1130597564 15:85257875-85257897 CTGAGAGCAGCTGGGGCTGCAGG + Intergenic
1131088468 15:89599161-89599183 GTGGGGGCGGGGGTGGCTGCTGG - Intronic
1131263746 15:90903444-90903466 CCGAGGGCGGTGGCGGCGGGGGG + Intronic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132552835 16:560428-560450 CGGGCGGCGGCGGAGGCTGCGGG + Exonic
1132561882 16:598952-598974 CCGGGGCCGGCGGCTGCTGCTGG + Intronic
1132579868 16:679944-679966 CTGATGGGGCCGGCGGCTGGGGG + Intronic
1132650609 16:1019883-1019905 CGGAGGGCGCAGGCGCCTGCAGG + Intergenic
1132733123 16:1372712-1372734 CAGAGGACCGCAGCGGCTGCAGG + Intronic
1132804250 16:1768419-1768441 CTGGGGGAGGCGGCGGCCACTGG - Intronic
1132885642 16:2180925-2180947 CTGTCGGCGGCAGCAGCTGCGGG + Exonic
1132893233 16:2214784-2214806 CGGCGGGCGGCGGCGGCCGGCGG - Exonic
1132939361 16:2499280-2499302 CTGGGGCCAGCGGAGGCTGCAGG + Intronic
1133156452 16:3880137-3880159 CCGGCGGCGGCGGCGGCGGCCGG - Exonic
1133156547 16:3880403-3880425 CTCACGGCGGCGGCGGCGGCGGG - Exonic
1133325024 16:4937059-4937081 GTGCGGGCGGCGGCGGCTGGCGG + Exonic
1133377605 16:5301261-5301283 CTGAGGGCCTCAGTGGCTGCTGG - Intergenic
1133784385 16:8963447-8963469 CGGCGGGCGGCGGCGGCGGCAGG + Exonic
1134066728 16:11233139-11233161 CTGGGGGTGGCAGCGGCTGCCGG + Intergenic
1134070457 16:11256710-11256732 CTGAGGGCGTCGACGGCGGGTGG - Intronic
1136146739 16:28320716-28320738 CCGAGAGCGGCAGCGGCTCCCGG + Exonic
1136550414 16:30979750-30979772 CTGAAGAGGGCGGCGGGTGCGGG - Exonic
1137617691 16:49856916-49856938 CAGGCGGCGGCGGCGGCGGCCGG + Intronic
1137683287 16:50369030-50369052 CACAGGGTGCCGGCGGCTGCGGG + Intergenic
1138105267 16:54284526-54284548 GCGAAGGCGGCGGCGGCAGCCGG + Exonic
1138450843 16:57092761-57092783 GTGAGGGCGGTGGCGCCCGCGGG + Exonic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1140223219 16:73058569-73058591 CTGGCGACGGCGGCGGCGGCGGG + Intronic
1140822973 16:78680164-78680186 CTGAGGGAGGCTGAGGCTGGTGG + Intronic
1141054640 16:80804083-80804105 CGGCGGGCGGCGGCGGCGGGCGG - Intronic
1141292022 16:82727083-82727105 ATGAGGGCGGCGGCGGTGGTGGG + Intronic
1141443364 16:84043195-84043217 TTGGGGGAGGCGGCGGCTGCTGG + Intergenic
1141484390 16:84329184-84329206 CTGATGGTGGCGGTGGCGGCGGG + Intronic
1141840105 16:86568523-86568545 GCGGGGGCGGCGGCGCCTGCGGG - Exonic
1142206263 16:88784674-88784696 GGAAGGGCGGCGGCGGCTGGGGG - Intronic
1142292979 16:89201218-89201240 CTGGGGGCGGGGAGGGCTGCGGG + Intronic
1142419342 16:89960864-89960886 CTGAGGGTGGCCTGGGCTGCAGG + Intronic
1142474639 17:181556-181578 CGGGGCGCGGCGGGGGCTGCGGG + Exonic
1142596268 17:1031519-1031541 CGGGGGGCTGCGGGGGCTGCGGG - Intronic
1142631442 17:1229009-1229031 CGGGGGGCGGCGGCCGCAGCGGG - Intronic
1142762424 17:2050234-2050256 CCGGGCGCGGCGGCGGCGGCCGG + Intergenic
1143954054 17:10655161-10655183 CTGAGGGCTCCTGCGGCTGAAGG - Intronic
1144500959 17:15786478-15786500 CTGACGGCGGCGGGGGTTGGGGG + Intergenic
1144500993 17:15786592-15786614 CTGAGGCCGGCGGCACCTCCAGG - Intergenic
1144536923 17:16099141-16099163 GTGAGCGGGGTGGCGGCTGCTGG - Intronic
1144833046 17:18142360-18142382 CTGAGGGTGGAGGCCTCTGCAGG + Intronic
1145163120 17:20589140-20589162 CTGACGGCGGCGGGGGCTGGGGG + Intergenic
1145163160 17:20589267-20589289 CTGAGGCCGGCGGCAGTTCCAGG - Intergenic
1145277001 17:21437518-21437540 CTGAGGGCAGAGGCAGCAGCAGG - Intergenic
1145314832 17:21723411-21723433 CTGAGGGCAGAGGCGGCAGCAGG - Intergenic
1145713273 17:26995348-26995370 CTGAGGGCAGAGGCGGCAGCAGG - Intergenic
1145925651 17:28644947-28644969 CCGGCGGCGGCGGCGGCGGCGGG - Intronic
1146142390 17:30379182-30379204 CTGAGGGAGGCGGCGGCCGCGGG + Exonic
1146339608 17:32007675-32007697 ACGTGGGCGGCGGCGGCGGCGGG - Intergenic
1146371133 17:32266153-32266175 CCGGGGGCGGCGGCGGCTGCGGG - Intergenic
1146902822 17:36599533-36599555 CGGAGGGAGGAGGCCGCTGCCGG + Intronic
1147168556 17:38605575-38605597 CCGGGGGCGGGGGCGGCGGCCGG - Intronic
1147315303 17:39617584-39617606 CAGACGGGGGCGGGGGCTGCAGG - Intergenic
1147819890 17:43235161-43235183 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147821202 17:43242559-43242581 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147822006 17:43247048-43247070 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147825610 17:43268007-43268029 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147826741 17:43274474-43274496 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147827630 17:43279352-43279374 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147828737 17:43285513-43285535 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147830925 17:43297786-43297808 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147831624 17:43301415-43301437 CAGAGGGCAGGGGTGGCTGCCGG + Intergenic
1147971164 17:44219709-44219731 CTGAGGCCGGGGCCGGCGGCGGG - Intronic
1147979921 17:44268087-44268109 CAGAGGGCACCAGCGGCTGCAGG - Exonic
1148156929 17:45429966-45429988 GTGAGCGCGGCGGCGACCGCGGG - Intronic
1148208048 17:45791929-45791951 CTGAGGGAGGTGGCAGGTGCGGG - Intronic
1148268241 17:46243607-46243629 CTGCGGGCGGCGGCGGCGCGGGG + Intergenic
1148617962 17:49014324-49014346 CTGAGGGGGACGGCGACTGGGGG - Intronic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1148836566 17:50468837-50468859 CTGGGGGCAGCAGCGGCGGCGGG + Exonic
1149626558 17:58084057-58084079 CAGAGGGTGGCGGTGGCGGCAGG - Intronic
1149678449 17:58487547-58487569 CTGAGAACGGCGGCGGTGGCGGG + Intronic
1149678504 17:58487746-58487768 CCGCGGGCGGCGGCGGCTGCTGG + Exonic
1150168407 17:62966385-62966407 CGGAGGGCGGTGGCGGCGGGAGG - Intergenic
1150250287 17:63700818-63700840 CCGAGGGCTGGGGGGGCTGCCGG - Intronic
1150363459 17:64559660-64559682 CTTAGGGAGGCGGAGGCTGGAGG + Intronic
1150790833 17:68199250-68199272 GTGAGCGCGGCGGCGGCAGCGGG + Intergenic
1151736050 17:75941014-75941036 CTGAGGGTGCCGGCAGCGGCTGG - Exonic
1151828628 17:76537343-76537365 GGGAGGGCGGCAGCGGCTCCGGG - Intronic
1151945927 17:77319869-77319891 CTCGGGGCGGCGGGGGCTGGAGG + Intronic
1152574595 17:81134486-81134508 CTGAGCGGGGCGCCGTCTGCGGG + Exonic
1152586219 17:81190618-81190640 AGGTGGGCGGCGGGGGCTGCAGG - Exonic
1152721898 17:81927505-81927527 GTGAGTGCGGCTGCGGCGGCGGG - Intronic
1154291619 18:13113136-13113158 GTGAGGGGGGCGGCGGCTACAGG - Intronic
1154303949 18:13217635-13217657 CAGACGGCGGCGACGGCGGCGGG + Intronic
1155007326 18:21740992-21741014 CGGAGCGCGGCGGCTGGTGCGGG + Intronic
1155218409 18:23662867-23662889 CTGTGTGCGGCGGCTGCTGCCGG - Exonic
1155654571 18:28178001-28178023 GCGAGGGCGGCGGCGGCGGCGGG - Intergenic
1157332686 18:46714988-46715010 CTGCGGCCGGCTGAGGCTGCTGG - Intronic
1157384188 18:47247928-47247950 CTGAAGGCGGCGGCCGCGGCAGG + Intronic
1157695059 18:49716058-49716080 CTGGGGGAAGGGGCGGCTGCAGG - Intergenic
1157706801 18:49813964-49813986 CGGGGCGCGGCGGCGGCGGCGGG + Intronic
1158435947 18:57435679-57435701 CCGGGGGCGGCGGGGGCGGCGGG - Exonic
1158579938 18:58671936-58671958 CTGAGCGCGGCGGGGGCCGCCGG + Intronic
1158758033 18:60349941-60349963 CAGAAGGCTGCGGCTGCTGCTGG + Intergenic
1158954140 18:62523553-62523575 CGGGCGGCGGCGGCGGCGGCGGG - Exonic
1159309222 18:66686724-66686746 CTGAGAGCAACGGCGGCTGGGGG - Intergenic
1159782337 18:72674853-72674875 CTGGGGGTGGCTGCGGCTGGAGG - Intergenic
1160204507 18:76822304-76822326 GTGGGGGCGGGGGCGGCGGCGGG - Intergenic
1160540233 18:79617161-79617183 CTGGGGGCGGCCGGGGCTGCCGG - Intergenic
1160834287 19:1117276-1117298 CTGAGGGCGGCCGGGCCTGCAGG - Intronic
1160923890 19:1533824-1533846 CTGCCTGCGGCGGCGGCTGCGGG + Intronic
1160967822 19:1754301-1754323 GTGGCGGCGGCGGGGGCTGCGGG - Exonic
1160987273 19:1844865-1844887 CTGAGGGAGGCAGAGGCTGAGGG - Intronic
1161069656 19:2253725-2253747 GGGGCGGCGGCGGCGGCTGCAGG + Exonic
1161107534 19:2452051-2452073 CTGGGGGCGGGGGCAGGTGCAGG - Intronic
1161190264 19:2950624-2950646 CTGAGGGAGACGGCCGCCGCGGG + Intergenic
1161203629 19:3029164-3029186 GCGAGGGCGGCCGCGGCAGCCGG + Exonic
1161243111 19:3233947-3233969 CTGAAGACGGCGGCGCCTGGAGG + Intronic
1161264793 19:3359348-3359370 GCGGTGGCGGCGGCGGCTGCAGG - Intergenic
1161592865 19:5136624-5136646 CTGGGGGTGGGGGCGTCTGCTGG - Intronic
1162486084 19:10961245-10961267 CCGAGGGGGGAGGGGGCTGCCGG + Intronic
1162535841 19:11262479-11262501 CGGGAGGCGGCGGCGGCGGCGGG - Intronic
1162783768 19:13021571-13021593 CTGAGGGAGAGGGCGGCTGTAGG + Intronic
1162959659 19:14118211-14118233 CTCAGTGCGGCAGCGGCTGTCGG + Intergenic
1163153055 19:15425912-15425934 GAGAAGGAGGCGGCGGCTGCGGG + Intronic
1163282231 19:16324999-16325021 GTGAGGGCGGCGGGGACGGCGGG + Intronic
1163601450 19:18251684-18251706 CCGAGGGCGGGGGCGGGGGCGGG - Intronic
1163753433 19:19092322-19092344 CTGAGGGCAGCTGGGGCTGGGGG - Intronic
1164639258 19:29812349-29812371 GTGAGGGCGGCGGGGGCGGCGGG + Intronic
1164693588 19:30227734-30227756 GCGGCGGCGGCGGCGGCTGCCGG - Intergenic
1165843294 19:38802270-38802292 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1165850858 19:38849700-38849722 CGGCGGGCGGCGGCGGCGGTGGG - Exonic
1165879505 19:39032286-39032308 CTGCGCGCCGCGGAGGCTGCTGG - Intronic
1165928698 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG + Intronic
1166083251 19:40458273-40458295 TGGTGGGCGGCGGCGGCGGCAGG + Intronic
1166126320 19:40717225-40717247 AGGAGGGCGGCGGCGGCAGCCGG + Exonic
1166296691 19:41893378-41893400 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166296708 19:41893417-41893439 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296724 19:41893456-41893478 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296741 19:41893495-41893517 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296773 19:41893572-41893594 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296789 19:41893610-41893632 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296803 19:41893648-41893670 CTGAGGGAGGAGGAGGCTGGGGG + Intronic
1166296834 19:41893725-41893747 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296851 19:41893764-41893786 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296867 19:41893803-41893825 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296898 19:41893879-41893901 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296914 19:41893917-41893939 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166306220 19:41938397-41938419 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166306328 19:41938695-41938717 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166306341 19:41938733-41938755 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166306363 19:41938807-41938829 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166306537 19:41939289-41939311 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166306550 19:41939327-41939349 CTGAGGGAGGAGGCTGCTGGGGG - Intergenic
1166375157 19:42323855-42323877 CTGGGGGCGGCGGCGGGGCCGGG - Intronic
1166571834 19:43802125-43802147 CTGAGGGAGGAGGAGGCTGGGGG - Intronic
1166571847 19:43802163-43802185 CTGAGGGAGGAGGGGGCTGGGGG - Intronic
1166702655 19:44891229-44891251 GTGGTGGCGGCGGCGGCAGCGGG + Exonic
1166805695 19:45485656-45485678 CAGAGGGCTGCGGGGGCTGGGGG + Exonic
1166829905 19:45632956-45632978 CGTGGGGCGGCAGCGGCTGCAGG + Exonic
1166838400 19:45681658-45681680 CAGAGGGCGGGGGCGGCGGCCGG - Intronic
1166883009 19:45940368-45940390 TTGGCGGCGGCGGCGGCTGCTGG + Exonic
1166888043 19:45973417-45973439 GTGGCGGCGGCGACGGCTGCTGG + Exonic
1166888063 19:45973468-45973490 GCGGGGGCGGCGGCGGCTGCGGG + Exonic
1167001054 19:46746069-46746091 ATGGCGGCGGCGGCGGCAGCGGG + Exonic
1167073419 19:47233926-47233948 CTGAGGGAGGCGGAGGCAGGAGG - Intergenic
1167103746 19:47419085-47419107 CTGAGGCCGGCGGCAGCTCCTGG + Exonic
1167258075 19:48442923-48442945 AGGAGGGCGGCGGCTTCTGCGGG - Exonic
1167286089 19:48599600-48599622 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1167369525 19:49072342-49072364 CGGTGGGCGGCTGCGGCGGCCGG - Exonic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167410034 19:49339074-49339096 CTGAAGGGGGCGGGGTCTGCAGG + Intronic
1167488285 19:49776193-49776215 ATGCGGGCGGCGGCGGGGGCGGG - Intronic
1167489254 19:49782247-49782269 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1167494592 19:49810154-49810176 CTGGGGGAGGTGGAGGCTGCCGG + Intronic
1167622981 19:50568973-50568995 TGGAGGGCGGCGGGGGCTGTGGG + Intergenic
1167668980 19:50838943-50838965 CTGAGGGAGGAGGAGGCTGGGGG + Intergenic
1167708872 19:51098374-51098396 CTGAGGGAGGAGGGGGCTGGGGG - Exonic
1167738207 19:51310424-51310446 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1167741482 19:51326999-51327021 CTGAGGGAGGCGGGGGCTGGGGG + Intronic
1167743890 19:51340034-51340056 CAGCGAGCGGCGGCGGCGGCCGG + Exonic
1167781568 19:51601910-51601932 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1168064059 19:53909425-53909447 CCGGTGGCGGCGGCGGCGGCCGG + Exonic
1168185886 19:54698927-54698949 CTGAGTGCTGGGGAGGCTGCAGG - Intronic
1168335936 19:55597807-55597829 CTGGGGGCGGCAGCGGCGGGCGG + Exonic
1168340824 19:55622157-55622179 GTGATGGCGGCGGCGGCGGCGGG - Exonic
1168694407 19:58396560-58396582 GCGGGGGCGGCGGCGGCCGCAGG - Exonic
925146399 2:1585871-1585893 CTGAGGGGGTGGGCGGCTGCGGG + Intergenic
926077322 2:9951738-9951760 GAGGCGGCGGCGGCGGCTGCGGG - Exonic
927518274 2:23684729-23684751 CTGTGGGTGGGGGCGGGTGCTGG - Intronic
927841737 2:26449394-26449416 CTGAGGGCAGCTGCTGCTGAAGG + Intronic
928449221 2:31364125-31364147 CTGGGTGCAGGGGCGGCTGCAGG + Intronic
929133578 2:38602453-38602475 GCGATGGCGGCGGCGGCGGCCGG - Exonic
929821943 2:45281110-45281132 CTGGGGGACGCGGCGGCTGATGG + Intergenic
930011253 2:46940379-46940401 CTGTGAGCTGCGGCGGCAGCGGG + Intronic
930046235 2:47175777-47175799 CCGAGCGGGGCGGCGGCTCCGGG + Intronic
930937302 2:56969737-56969759 GTGAGGGGGGCGGGGGCTGAAGG - Intergenic
931602646 2:64019396-64019418 CTGGGGGCTGCGGCGGCCTCCGG - Intergenic
931739279 2:65227767-65227789 CGGAGCCCGGCGGCGGCTTCCGG + Intronic
932436773 2:71706374-71706396 CTGAGGGCGGTGGGGGCTGCAGG + Intergenic
932599297 2:73112874-73112896 CTGAGCGCCGCCGCAGCTGCGGG + Exonic
932827930 2:74958680-74958702 ATGGCGGCGGCGGCGGCGGCAGG + Exonic
933603228 2:84354486-84354508 CTGGGGGAAGTGGCGGCTGCGGG + Intergenic
933810094 2:86027750-86027772 CTGAGGGGAGCGGGGGCGGCTGG - Intronic
934892993 2:98087074-98087096 CTGTGGGCGGGGCCGGCTCCAGG + Intergenic
934926493 2:98385242-98385264 TTGAGGGCAGCGCCGTCTGCTGG + Intronic
934966805 2:98730948-98730970 TTGGGGGCGGCGCCGGCGGCCGG - Intronic
935301673 2:101698184-101698206 CTGGGCGCGGCCCCGGCTGCCGG - Intronic
935592557 2:104855611-104855633 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
935971397 2:108534119-108534141 CGGAGCGCGGCGGCGGCTCGGGG - Intergenic
936512191 2:113157440-113157462 CTGGGGGCGGCGAGAGCTGCGGG - Intronic
937201389 2:120206509-120206531 CTGAGGGCGGGCACAGCTGCAGG + Intergenic
937272486 2:120661920-120661942 CTGAGGGCCAGGGCGCCTGCTGG - Intergenic
938406243 2:131034874-131034896 GCGGGGGCGGCGGCGGCGGCGGG - Intronic
938440854 2:131331151-131331173 CAGCTGGCGGCGGCGGCGGCGGG + Intronic
938487392 2:131724349-131724371 GTGGTGGCGGCGGCGGCAGCGGG - Intronic
938895073 2:135741860-135741882 CGGAGGGCGGAGCCGGCTTCGGG + Exonic
939432659 2:142130785-142130807 CCGGCGGCGGCGGCGGCGGCAGG + Exonic
939492058 2:142888212-142888234 CTTAGGGAGGCGGAGGCTGGAGG + Intronic
941020928 2:160407538-160407560 CGGGCGGCGGCGGCGGGTGCGGG + Intronic
941666424 2:168247544-168247566 GGGACGGCGGCGGCGGCGGCGGG - Exonic
942046516 2:172102299-172102321 CGGCGGGCGGCGGCGGCGGCGGG - Exonic
942150915 2:173075677-173075699 CTGGGGGCCTCGGCGGGTGCCGG + Intronic
942919490 2:181354220-181354242 CTGAAGGCAGCGGTGGTTGCTGG + Intergenic
944412849 2:199459319-199459341 CTGCCGGCGGCCGCGGCCGCGGG - Intronic
944573782 2:201071634-201071656 CTGCGGGAGGCGGCGGCGGTAGG - Exonic
945927459 2:215819870-215819892 CTGGGGGAAGGGGCGGCTGCAGG + Intergenic
946310222 2:218879118-218879140 CTGACAGCTGCGGTGGCTGCCGG + Intergenic
946410508 2:219513089-219513111 CTGAGGGAAACGGCAGCTGCTGG - Intergenic
947549772 2:231037812-231037834 CAGAGGGCGGCGAGGGCGGCTGG + Exonic
948075677 2:235163649-235163671 CTGAAGGCTGCGGTGTCTGCAGG - Intergenic
948099463 2:235361975-235361997 CTGAGGGCGTGTGCGGCTGAAGG - Intergenic
948438127 2:237967395-237967417 GTGACCGCGGCGGCGGCGGCGGG + Intronic
948824682 2:240568505-240568527 CGCCGGGCGGCGGCGGCGGCGGG - Intronic
948828554 2:240586355-240586377 CTGGGAGCGGCGGCGCATGCTGG + Intergenic
948927494 2:241108639-241108661 CTGAGGGCCACGGGAGCTGCAGG + Intronic
949004634 2:241638034-241638056 TGGAGGGCGGCGGAGCCTGCCGG + Intronic
949050452 2:241894988-241895010 CTGAAGGAAGCGGCAGCTGCGGG - Intronic
1169065641 20:2693009-2693031 CTGGCGGCGGCGGCGTCTGCTGG + Exonic
1169328722 20:4699372-4699394 CTCAGGGCGGTGGTGGCTGGGGG + Exonic
1171123421 20:22583687-22583709 CGGAGTGCGGGGGCGGCTGGAGG + Intronic
1171439443 20:25148521-25148543 CGCAGGGCGGCGGCGGAGGCCGG - Intergenic
1172474531 20:35226889-35226911 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1173747151 20:45446558-45446580 CTGAGGGCAGCCTCGCCTGCTGG - Intergenic
1174017671 20:47501942-47501964 TGGCGGCCGGCGGCGGCTGCGGG + Exonic
1174266984 20:49339087-49339109 CTGAGGGAGGGGGCGTGTGCAGG - Intergenic
1174380694 20:50153667-50153689 CTGCTGGCGGCGGCGGCGGCAGG + Exonic
1174386665 20:50191525-50191547 CGGCGGGCGGCGGCGGCGGCGGG - Exonic
1174494599 20:50930872-50930894 CGGACAGCGGCGGCGGCGGCGGG + Exonic
1174656392 20:52175855-52175877 TTGGGGGCGGGGGCGGCAGCGGG - Intronic
1174822826 20:53742209-53742231 CTGTGGGAGGCCGCGGCTGGTGG - Intergenic
1175108793 20:56631423-56631445 CTGTGGGCGCCGGCTGGTGCAGG - Exonic
1175319642 20:58076234-58076256 CTGATGGTGGAGGCTGCTGCTGG - Intergenic
1175340936 20:58228604-58228626 CGGCGGGCGGCGGCGGGGGCGGG - Exonic
1175349798 20:58309739-58309761 ATGGCGGCGGCGGCGGCTCCCGG + Exonic
1175369729 20:58480222-58480244 CTGAAGGCTGCGGCGGGTGGAGG - Intronic
1175429535 20:58891706-58891728 ATGGCGGCGGCGGCGGCGGCGGG - Intronic
1175946491 20:62561355-62561377 CTGGGGACGGCTGCGGCTGCAGG + Intronic
1176062252 20:63177604-63177626 GCGACGGCGGCGGCGGCGGCGGG + Intergenic
1176068921 20:63216015-63216037 CGGGCGGCGGCGGCGGCTGCTGG + Exonic
1176157020 20:63627022-63627044 CGGGCGGCGGCGGCGGCCGCGGG + Intronic
1176159549 20:63641422-63641444 CTGAGGGCGGGGGTGGCTTGGGG + Intronic
1176255048 20:64147297-64147319 CTGAGGGAGGCTGCGGCTGGTGG - Intergenic
1176380091 21:6108001-6108023 CTGAGGGTGGAGGGGGCTGGGGG + Intergenic
1176549733 21:8216029-8216051 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1176550165 21:8217358-8217380 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176557624 21:8260258-8260280 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1176568658 21:8399063-8399085 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1176577007 21:8444628-8444650 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1179626793 21:42653638-42653660 CGGCGCGCGGCGGCGGCTCCCGG + Intronic
1179743383 21:43430237-43430259 CTGAGGGTGGAGGGGGCTGGGGG - Intergenic
1180042858 21:45288711-45288733 CTGCGGGGAGCGGCGGCGGCGGG - Intergenic
1180095924 21:45555296-45555318 CAGGGGGCGGCGGGGGCGGCGGG + Intergenic
1180141275 21:45894672-45894694 GTGTGGGCGGCGGCAGCTACTGG - Intronic
1180559340 22:16602341-16602363 CCGCGGGCGGCGGCAGCTCCCGG + Intergenic
1180614758 22:17120202-17120224 CTGGGGGCGGCCGCGGCAGCGGG - Exonic
1180960669 22:19760999-19761021 CGTAGCGCGGCGGCGGCGGCGGG - Exonic
1180961935 22:19766181-19766203 CTGCGGGCGGCGGCGGCGGCGGG - Intronic
1181060870 22:20281498-20281520 CTGAGGGAAGCGGAGGGTGCAGG + Intronic
1181160657 22:20957783-20957805 CTGTGGGCCGGGGCAGCTGCGGG + Intergenic
1181299185 22:21867418-21867440 ATGGCGGCGGCGGCGGCGGCGGG - Exonic
1181523185 22:23460854-23460876 CAGATGGCGGCGGCTGCTGAGGG - Intergenic
1181979608 22:26756825-26756847 CTGACGGCGGCGGGGGCGGCCGG + Intergenic
1182338848 22:29603514-29603536 CTGAGGGCGGGGCCGGGAGCAGG + Intergenic
1182586361 22:31346207-31346229 GTGGCGGCGGCGGCGGCGGCTGG + Exonic
1183590911 22:38778862-38778884 CTGGGGGCTGGGGGGGCTGCTGG + Exonic
1183736358 22:39646891-39646913 CTGAGTGCCGCGTCGGATGCAGG - Intronic
1183739478 22:39662089-39662111 CGGAGCGCGGCGGCGGCGCCCGG + Exonic
1183815146 22:40293607-40293629 CTGAGGGCGGGGGCGGAGGGGGG + Intronic
1184122288 22:42459852-42459874 CTGAGGGCAGAGTCCGCTGCTGG - Intergenic
1184281608 22:43440682-43440704 GTGAGGGCTGCGGAGGCTGCAGG - Intronic
1184403119 22:44285519-44285541 CTGGGGGAGGCTGCGGCTGTGGG + Exonic
1184465843 22:44668636-44668658 CTGGGGGCTGCGGCGGCTGCGGG + Intronic
1184767032 22:46577396-46577418 CGGGCGGCGGCGGCGGCGGCGGG - Intronic
1184770077 22:46591876-46591898 CTGAGGGGTGCGGGGGCTGAGGG - Intronic
1185179809 22:49352833-49352855 CAGAGGGCGGCCCCGGCTGGAGG - Intergenic
949987523 3:9552697-9552719 CCGGCGGCGGCGGCGGCTGGCGG + Exonic
950282294 3:11719158-11719180 CTGAGGCCGGCGGGGACCGCGGG + Intronic
950316307 3:12004644-12004666 GCGGCGGCGGCGGCGGCTGCTGG - Exonic
951080300 3:18444721-18444743 CCGGCGGCGGCGGCGGCGGCAGG - Intronic
952744451 3:36764221-36764243 CCGGGGGCGGCGGCGGCTGCGGG + Intergenic
953672698 3:44976133-44976155 GTGGCGGCGGCCGCGGCTGCAGG + Exonic
954632794 3:52056296-52056318 TCGGGGGCGGCGGCGGCTGGGGG - Exonic
954970094 3:54644790-54644812 CTGAGTGCTGCGGAGGCTGCTGG + Intronic
960747805 3:120908773-120908795 GAGAGCGCGGCGGCGGCTGCGGG + Intronic
960753572 3:120983153-120983175 CTGAGGGTGGCAGAGGCAGCAGG + Intronic
961754919 3:129121835-129121857 CTGAGGGCGGAGCCGGGGGCGGG - Intronic
961754955 3:129121928-129121950 CTGAGGGCGGAGTCGGGGGCGGG - Intronic
961827628 3:129606986-129607008 GCGACGGCGGCGGCGGCTACGGG - Intergenic
962770878 3:138609083-138609105 CTCTGGGCGGCGGCGGCGGGCGG + Intronic
963835154 3:150050723-150050745 AAGATGGCGGCGGCGGCGGCGGG + Intronic
964265391 3:154889502-154889524 CCGAGGCCGGCGGCGCCAGCCGG + Intergenic
964771114 3:160225420-160225442 CTGCGGGAGGCGGCTGCTACTGG - Intergenic
965590626 3:170357594-170357616 GAGACGGCGGCGGCGTCTGCGGG + Intergenic
966866092 3:184259929-184259951 ATGAGCGCGGCGGCGGGTTCCGG + Exonic
968051242 3:195656433-195656455 CTGTGGGCTGCTGCGGCTGAGGG + Intergenic
968104581 3:195991905-195991927 CTGTGGGCTGCTGCGGCTGAGGG - Intergenic
968302872 3:197629488-197629510 CTGTGGGCTGCTGCGGCTGAGGG - Intergenic
968434195 4:576418-576440 CCGGGGGTGGCGGGGGCTGCCGG - Intergenic
968471915 4:786350-786372 GTGAGGGAGGCGGCGGGCGCGGG + Exonic
968520398 4:1032418-1032440 CTGGGGGCCGAGGCGGCTCCTGG + Intergenic
968659641 4:1793710-1793732 CCCTGGGCGGCGGCGGCGGCGGG + Intronic
968665615 4:1820544-1820566 CTGAGGGTGACGGCAGCTGGAGG + Intronic
968674735 4:1871431-1871453 GAGGGGGCGGCGGCGGCGGCGGG - Intronic
968674902 4:1871848-1871870 CTGCGGGCGGCGGCGGCTAACGG + Intronic
968850352 4:3074169-3074191 CTGAGGGGCGGGGCGGCTGAGGG - Intergenic
968874055 4:3255968-3255990 CAGCAGGCGGCGGCGGCGGCGGG + Exonic
968920043 4:3517789-3517811 CAGAGGGCAGTGGCGGCAGCGGG - Intronic
968939763 4:3631640-3631662 CCGAGGGAGGAGGTGGCTGCTGG + Intergenic
970333011 4:15003722-15003744 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
970585666 4:17512032-17512054 ATGGCGGCGGCGGCGGCTGCAGG - Exonic
971943156 4:33241228-33241250 CTGAGGGAGGAGGCGGCTGTGGG - Intergenic
972765861 4:42151957-42151979 CGAAGGGCGGCGGGGGCGGCGGG + Exonic
974747906 4:66100091-66100113 CTGGGCGCGGCGGCGGGCGCCGG + Intergenic
976177954 4:82373554-82373576 CAGGGGGCAGCGGCGGCGGCGGG - Exonic
976431243 4:84966004-84966026 CTGGCGGCGGCGGCGGCTCCCGG + Intronic
976629301 4:87220477-87220499 CTGAGGGCGGCCGGGGCTCTGGG - Exonic
976874318 4:89836186-89836208 CTGAGGGCGGGGGTGGATGTTGG - Intronic
977908225 4:102501457-102501479 CCGAGGGCTGCGGCGGCTGGCGG - Exonic
978333644 4:107643269-107643291 CTGAGCGGGGCGACAGCTGCTGG - Intronic
979832040 4:125315654-125315676 GCGGCGGCGGCGGCGGCTGCAGG + Intergenic
980075224 4:128287547-128287569 CTGGGGGCGGCGGGGTCTGGGGG - Exonic
980130071 4:128809988-128810010 GCGGCGGCGGCGGCGGCTGCAGG + Intronic
980930116 4:139176876-139176898 CGGAGGGAGGCGGCGGCAGTCGG + Intronic
981044586 4:140253257-140253279 TGGAAGGCGGCGGCGGCGGCAGG + Intergenic
981713574 4:147732061-147732083 CAGAGCTCGGCGGGGGCTGCCGG + Exonic
982794494 4:159629308-159629330 CTGGGGGAAGCGGCGGCTGTGGG - Intergenic
984206289 4:176792214-176792236 TCGAAGGCGGCGGCGGCGGCGGG + Exonic
984952382 4:185017170-185017192 AGGAGGGGGGCGGCGGCGGCTGG - Intergenic
985507931 5:295073-295095 CTGTGGGCTGCTGCGGCTGAGGG + Intronic
985521010 5:373899-373921 GTGACGGCGCCGGCGGCTGCGGG + Intronic
985791694 5:1931583-1931605 CCGCGGGTGGCGGCGGCTGTGGG - Intergenic
985814432 5:2116100-2116122 CGGAGGCTGGCGGCAGCTGCTGG - Intergenic
986775312 5:11008750-11008772 CTGAGGGTGGAAGCGGCTGGTGG + Intronic
987087993 5:14487542-14487564 GTGGGGGCAGCGGCGGCGGCGGG + Exonic
987340651 5:16936315-16936337 GGGAGGGCGGGGCCGGCTGCGGG - Intergenic
987340660 5:16936335-16936357 GGGAGGGCGGGGCCGGCTGCGGG - Intergenic
989103325 5:37839692-37839714 CTGTTGGCGGCGGCGGCGGCGGG - Intergenic
989812681 5:45696282-45696304 CTAAGGGCAGCGGCGGCGGCGGG - Intergenic
990743686 5:58937207-58937229 CTGGGGGCGGGGGCGGGGGCGGG + Intergenic
990955027 5:61332325-61332347 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
992105637 5:73447590-73447612 AAGAGCGCGGCGGCGGCTGCCGG + Exonic
992312091 5:75511437-75511459 GCGACGGCGGCGGCGGCTGACGG - Exonic
992399995 5:76403292-76403314 CTGCGGGAGGCGGCGGCGACCGG + Exonic
994043628 5:95284678-95284700 GTGGCGGCGGCGGCGGCGGCGGG + Intergenic
997319161 5:132963585-132963607 CTGGCGGCGGCGACGGCAGCTGG + Exonic
997975462 5:138439241-138439263 GTGAGTGCGGCGGCGGCGGGGGG + Intronic
1000060543 5:157651730-157651752 CTGACGCTGTCGGCGGCTGCAGG + Exonic
1001470242 5:172006692-172006714 CTGCGGGCCGCGGCGCCTGCTGG - Intronic
1002064879 5:176647137-176647159 CTGATGGCGCCGGAGGCCGCCGG - Intergenic
1002184262 5:177446961-177446983 GTGAGTACCGCGGCGGCTGCGGG + Intronic
1002352038 5:178590123-178590145 CGGCGGGCGGCGGCGGCGGAGGG - Exonic
1002424433 5:179166986-179167008 GGGAGGGAGGCGCCGGCTGCGGG + Intronic
1002455902 5:179345226-179345248 CGGGCGGCGGCGGCGGCGGCAGG + Exonic
1002559447 5:180071710-180071732 CCGCGAGCAGCGGCGGCTGCCGG - Exonic
1002897859 6:1389750-1389772 CTGGCGGCGGCGGCGGCGGCGGG - Intergenic
1002926570 6:1609051-1609073 GTGCGGGCGGCGAGGGCTGCCGG - Intergenic
1003035009 6:2634364-2634386 CTGCGGGCAGCGGGGCCTGCGGG - Intronic
1004216793 6:13711274-13711296 CCGGGGGCGGCGGCGGCGGAGGG + Exonic
1004396125 6:15248129-15248151 CCGTGGCTGGCGGCGGCTGCGGG + Intronic
1005040308 6:21595031-21595053 ATGGGGGCGGCGGCGGCGGCGGG + Exonic
1005040704 6:21596817-21596839 GAGCTGGCGGCGGCGGCTGCTGG + Exonic
1005959732 6:30686609-30686631 AGGAGGGCGGCGGCAGCAGCCGG + Exonic
1006123473 6:31822055-31822077 CTGAGGGCGGGGCTGGCTTCGGG - Intergenic
1006340735 6:33445216-33445238 CTGAGGAAGAGGGCGGCTGCAGG + Intronic
1006725498 6:36196788-36196810 CCGGGAGCGGCGGCGGCGGCCGG + Exonic
1006910372 6:37559521-37559543 CTGTGGTCGGAGGAGGCTGCAGG - Intergenic
1007410051 6:41656400-41656422 CCAGGGGTGGCGGCGGCTGCAGG - Intergenic
1007629133 6:43263107-43263129 CGAAGAGCGGCGGCGGCTGGGGG + Exonic
1008013376 6:46491409-46491431 GTGACGGCGGCGGAGGTTGCGGG - Intronic
1008932480 6:56954972-56954994 CTGAGGTCGGCGGCGGCCGCAGG - Intergenic
1009536732 6:64897001-64897023 CTGAGGGAAGGGGCGGCTGTTGG + Intronic
1010703305 6:79077779-79077801 GGGAGGGAGGCGGCGGCGGCGGG - Intronic
1010794827 6:80106733-80106755 CTCAGGGCGGCAGGGGCTGAGGG + Exonic
1012475775 6:99613748-99613770 CAGGCGGCGGCGGCGGCGGCGGG - Exonic
1013304183 6:108832939-108832961 CTGTAGGCGGCAGCGGATGCAGG + Intergenic
1013453048 6:110303710-110303732 CTGGGGGAAGGGGCGGCTGCGGG + Intronic
1014137712 6:117907818-117907840 CCGAGGGCAGCGGCGGCGGCGGG + Exonic
1014205554 6:118651694-118651716 CTGCGGGGGGCGGGGACTGCGGG + Intronic
1015910171 6:138161840-138161862 CTCCGCTCGGCGGCGGCTGCGGG - Intergenic
1016936069 6:149450471-149450493 CTGAGGCCGGGGCCTGCTGCGGG - Intronic
1017073749 6:150599901-150599923 CCGAGCCCGACGGCGGCTGCAGG + Exonic
1017738020 6:157381292-157381314 CCGAGGGCGGCGGCGGCTCGCGG - Exonic
1017852062 6:158313215-158313237 CTGAGGGGTGCGCCGGCTGGTGG + Exonic
1018434594 6:163749099-163749121 CTGAGGGCGGGGGCTCCAGCAGG + Intergenic
1018630692 6:165819512-165819534 CGGAGGTCGGAGGAGGCTGCCGG - Intronic
1018966194 6:168490928-168490950 CTGGGGGCAGCGGGGGCGGCTGG + Intronic
1019048912 6:169168428-169168450 CCCAGGGCGGCGGCGGCGCCAGG + Intergenic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019563861 7:1670301-1670323 TGAAGGACGGCGGCGGCTGCGGG + Intergenic
1019588145 7:1815704-1815726 CAGATGGCGGCGGCTGCTGAGGG + Intergenic
1019624455 7:2008943-2008965 CTGAGGGGTGCGGAGGCTGTGGG + Intronic
1019689669 7:2403617-2403639 GGGGCGGCGGCGGCGGCTGCGGG + Exonic
1019711439 7:2519873-2519895 CTGCGGCCGGCGCCTGCTGCTGG + Exonic
1020106247 7:5423538-5423560 CGGAGGGGAGCGGCGGCCGCGGG - Exonic
1020210276 7:6153841-6153863 CTGAGGCCGGCGGCCGCATCTGG - Exonic
1020274292 7:6615497-6615519 GCGACGGCGGCGGCGGCGGCGGG + Intergenic
1020278309 7:6637516-6637538 TCGGGGGCGGCGGCGGCGGCGGG + Intronic
1022090050 7:27102148-27102170 GTGGCGGCGGCGGCGGCGGCCGG + Exonic
1022091440 7:27110352-27110374 CCTGGGGCGGCGGCGGGTGCAGG + Exonic
1022101884 7:27173874-27173896 GCGGGGGCGGCGGCTGCTGCTGG + Exonic
1022103794 7:27184542-27184564 GCGGCGGCGGCGGCGGCTGCCGG - Exonic
1022363319 7:29684858-29684880 CTGAGGATGGCGGCGGCGGCCGG - Intergenic
1022428005 7:30285719-30285741 CTGAGGACGGCGGCGGCGGCCGG + Exonic
1023418129 7:39950785-39950807 GCGGGGGCGGCGGCGGTTGCAGG - Exonic
1023773688 7:43583336-43583358 CCTGGGGCGGCGGCGGCGGCCGG - Exonic
1023965641 7:44961974-44961996 CTGAGGGCTGAGGGGGCTGAGGG + Intergenic
1024064330 7:45720021-45720043 CTCAGGGCGGTGACCGCTGCAGG + Exonic
1024965380 7:55019121-55019143 GTCTGGGCGGCGGCGGCCGCCGG - Exonic
1025069778 7:55887835-55887857 CGGCGGGCGGCGGCGGCGGCGGG + Intronic
1025069796 7:55887883-55887905 CGGCGGGCGGCGGCGGCGGCGGG + Intronic
1026098356 7:67364785-67364807 CTGGGGCCAGCGGCGCCTGCTGG + Intergenic
1026974760 7:74490508-74490530 CAGAGGGAGGCTGAGGCTGCTGG + Intronic
1028597958 7:92566925-92566947 CTGAGGCCGGGGGCAGCGGCTGG + Intronic
1028856171 7:95596518-95596540 CCTCGGGCGGCGGCGGCTGGTGG - Intergenic
1029168933 7:98617439-98617461 CTGAGCGCGGCAGCGGCGGCGGG + Exonic
1029403119 7:100357542-100357564 CTGAGTGCGGTGGGGTCTGCAGG + Intronic
1029640375 7:101816338-101816360 GTGGTGGCGGCGGCGGCTCCCGG - Intronic
1029736850 7:102469828-102469850 GCGAGGGCGGCTGCTGCTGCTGG + Exonic
1029896382 7:103989274-103989296 CTGAGGGCGCGCGCGGCGGCTGG - Exonic
1030055844 7:105583164-105583186 CTGAGGGCGGGGGCGGCGGGGGG + Intronic
1032011794 7:128351980-128352002 CTGGGGCGGGCGGCGGCGGCGGG - Exonic
1032119317 7:129144955-129144977 CCGGGGGCGGTGGCGGCGGCGGG + Exonic
1033033218 7:137846774-137846796 GCGGCGGCGGCGGCGGCTGCAGG + Exonic
1033361289 7:140640589-140640611 GGGCGGGCGGCGGCGGGTGCCGG + Exonic
1033413782 7:141144891-141144913 CTCAGGGTGGCTGAGGCTGCAGG + Intronic
1034455555 7:151167981-151168003 GAGAAGGCGGCGGCAGCTGCTGG + Intronic
1034617902 7:152435478-152435500 CCGCGGGCGGTGGCGGCTCCCGG - Intronic
1034911574 7:155002685-155002707 CTGAGGGCAGGGGCGACCGCGGG - Intronic
1034978884 7:155463336-155463358 CTGCGGGCCTGGGCGGCTGCTGG - Exonic
1035318114 7:158010130-158010152 CTGAGGGCTGCTGGGGATGCCGG - Intronic
1035353976 7:158266053-158266075 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035353985 7:158266095-158266117 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035353994 7:158266137-158266159 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035354003 7:158266179-158266201 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035354012 7:158266221-158266243 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035354021 7:158266263-158266285 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035354030 7:158266305-158266327 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035354039 7:158266347-158266369 CTGGGGACGGCGTCTGCTGCGGG + Intronic
1035610768 8:962589-962611 CGGAGGGCGGGGGCCTCTGCTGG - Intergenic
1036561932 8:9905667-9905689 CTGCTGGCGGCGGCGGCCGGGGG + Intergenic
1037262888 8:17027478-17027500 CTGAGCGTGGCGGCGGCGGCCGG + Exonic
1037313182 8:17577362-17577384 AGGAGGGCGGCGGGGGCTTCGGG - Intronic
1038394383 8:27236435-27236457 CTGGGTGGGGCAGCGGCTGCAGG - Exonic
1038516686 8:28193522-28193544 TTGAGGACGGCGGGGGCTGCGGG - Intergenic
1038883662 8:31640279-31640301 AGGAAGGCGGCGGCGGCGGCGGG + Intronic
1039542334 8:38382325-38382347 CCGCGGGCCGCGGCGCCTGCCGG + Intergenic
1039801835 8:40964563-40964585 CTGAGGGAGGGGGTGGCTGTGGG + Intergenic
1039886111 8:41654634-41654656 CTGAGGACTTCTGCGGCTGCAGG - Intronic
1042040126 8:64581059-64581081 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
1042611666 8:70607788-70607810 CTGCGGGAGGGGGCGGCGGCGGG + Intronic
1044335972 8:90985228-90985250 CTGACCGCGGTGGCGGCGGCGGG + Exonic
1045115222 8:98973816-98973838 CTGAGGGAGGGGGAGGCCGCCGG - Intergenic
1045287603 8:100805379-100805401 CTGAGGGCAGAGGCAGCTGTTGG + Intergenic
1045516293 8:102863626-102863648 CCGGCGGCGGCGGCGGCGGCGGG - Intronic
1047381877 8:124372078-124372100 CGGGGCGCGGCGGCGGCGGCCGG + Exonic
1047916957 8:129593135-129593157 CTGAGGGCGATGGGAGCTGCAGG + Intergenic
1048214138 8:132480495-132480517 CGCAGGGCGGCGGGGGCGGCTGG - Exonic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049223114 8:141436863-141436885 CTGGGGGTGGTGGCGGCTGGTGG + Intergenic
1049347475 8:142146565-142146587 CCGAGGGCGGAGGCGTCTCCCGG - Intergenic
1049358862 8:142202355-142202377 CAGAGGGCGGAGACGGCGGCTGG - Intergenic
1049388852 8:142357944-142357966 CAAAGGGCGGCGGGGTCTGCTGG + Intronic
1049388867 8:142358004-142358026 CAAAGGGCGGCGGGGTCTGCTGG + Intronic
1049388882 8:142358064-142358086 CAAAGGGCGGCGGGGTCTGCTGG + Intronic
1049388911 8:142358184-142358206 CAAAGGGCGGCGGGGTCTGCTGG + Intronic
1049388926 8:142358244-142358266 CAAAGGGCGGCGGGGTCTGCTGG + Intronic
1049405407 8:142449964-142449986 CCGGGGGCGGCGGCGGCTGGAGG + Exonic
1049419531 8:142510709-142510731 CTCTCGGCGGCGGCGGCGGCGGG + Intronic
1049471749 8:142777819-142777841 GAGTGGGCGGAGGCGGCTGCGGG - Exonic
1049552627 8:143267496-143267518 CGGGCGGCGGCGGCGGCTCCGGG + Intronic
1049989407 9:977319-977341 GAGAGGCTGGCGGCGGCTGCGGG - Exonic
1052494727 9:29212471-29212493 GTGGGGGCGGCGGCGGCACCCGG - Intergenic
1053181254 9:35972256-35972278 CTGAGGGCGGGGGCGGCGTGGGG + Intergenic
1053381151 9:37650726-37650748 CTGAGGCAGGCGGCGGAGGCAGG + Intronic
1054450998 9:65403670-65403692 CCGAGGGAGGAGGTGGCTGCTGG - Intergenic
1054781937 9:69174010-69174032 CGGGAGGCGGCGGCGGCGGCAGG - Intronic
1055091118 9:72365283-72365305 CCGGCGGCGGCGGCGGCGGCGGG + Intergenic
1055823844 9:80300873-80300895 CTCAGGGAAGCGGCGGCTGTGGG - Intergenic
1056799477 9:89681374-89681396 CGGGGGGCGGGGGCGGCCGCCGG - Intergenic
1056799518 9:89681437-89681459 CGAGGGGGGGCGGCGGCTGCTGG - Intergenic
1057054252 9:91949319-91949341 GTGGGGGCGCCGGCGGCTCCCGG - Intronic
1057216120 9:93229883-93229905 CTGAGGGCTGGGGCGGGTCCTGG + Intronic
1057272566 9:93659143-93659165 CTGACGGAGGTGGTGGCTGCAGG - Intronic
1057489302 9:95508970-95508992 CTGCTGGCGGTGGCGGCTCCAGG + Intronic
1057596211 9:96417975-96417997 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1057619171 9:96619634-96619656 CTGGGGGCGCCGGCCGCGGCAGG - Exonic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1059474398 9:114532824-114532846 CTGACGGCGACGGCGGGGGCGGG + Intergenic
1060220054 9:121759763-121759785 CTGAAGGTGGAGGCGGCAGCGGG - Intronic
1060636131 9:125200810-125200832 CTGGTAGCGGCGGCTGCTGCGGG + Exonic
1060929507 9:127479889-127479911 CGCAGAGCGGCAGCGGCTGCAGG + Exonic
1060995885 9:127874758-127874780 CTGAGGGCAGAGGGGGCTGCTGG + Intronic
1061128290 9:128690001-128690023 GTGGCGGCGGCGGCGGCTGATGG - Intronic
1061141811 9:128771892-128771914 GCGGAGGCGGCGGCGGCTGCAGG - Exonic
1061541082 9:131278041-131278063 CAGGCGGCGGCGGCGGCGGCGGG + Intergenic
1061801544 9:133115727-133115749 CTGGGGCCGGCGACGGATGCTGG + Intronic
1061828546 9:133275902-133275924 GAGAGGGCGGCGGCGGCTGCAGG + Intergenic
1061890465 9:133616627-133616649 CAGAGGGCAGCCGCTGCTGCTGG - Intergenic
1062117674 9:134818052-134818074 CTGAGGGAGGAGGCGGGTGGTGG + Intronic
1062162470 9:135087830-135087852 CGCGGGGCGGCGGCGGCGGCGGG + Exonic
1062212286 9:135371664-135371686 CTGACGCTGACGGCGGCTGCAGG - Intergenic
1062214261 9:135380649-135380671 CTGGGGGCGGCGGGGGCTTTGGG - Intergenic
1062272238 9:135714817-135714839 TGAAGGGCGCCGGCGGCTGCGGG - Intronic
1062305763 9:135906706-135906728 CCGTTGGCGGCGGCGGCGGCGGG - Intronic
1062388897 9:136326409-136326431 CTGTGGGCGGCAGCTGCTGAGGG + Intergenic
1062574564 9:137200219-137200241 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1062584092 9:137241340-137241362 ATGATGGCGGCGGCGGCGGCGGG - Exonic
1203772758 EBV:57935-57957 CAGAGGGAGGCGGCGGCCGGAGG + Intergenic
1186599750 X:11024388-11024410 CTGGGGGAGGGGGCGGCTGTGGG - Intergenic
1186638180 X:11427926-11427948 CTGTCAGCGGCGGCGGCCGCCGG - Intronic
1186705898 X:12138830-12138852 CAGCGGGTGGCGGCGGCGGCCGG - Exonic
1186896482 X:14009152-14009174 CTCAGGGCGGCAGCAGCAGCTGG - Exonic
1186917893 X:14243891-14243913 CGGACGGCGGCGGCGGTGGCGGG + Intergenic
1187363692 X:18649977-18649999 CTGAGCGGGGCGGCGGCGGCGGG - Intronic
1188478023 X:30607587-30607609 CTGTGGGAGGCGGAGGCTGGAGG + Intergenic
1189324665 X:40105334-40105356 GTGACTGCGGCGGCGGCGGCGGG - Intronic
1189534604 X:41923526-41923548 GGGCGGGCGGTGGCGGCTGCGGG - Intergenic
1190246835 X:48696557-48696579 GTCTGGGCGGCGGCGGCAGCGGG - Intronic
1190337284 X:49270081-49270103 AAGATGGCGGCGGCGGCGGCGGG + Exonic
1191054964 X:56232245-56232267 CTGAGGGAGGCGGCCGCCGGAGG + Intergenic
1192123319 X:68477004-68477026 CTGCATGCAGCGGCGGCTGCTGG + Intergenic
1192473735 X:71420956-71420978 CAGCGGGCGGCTGGGGCTGCAGG - Intronic
1192952335 X:76029772-76029794 TTGAAGGTGGGGGCGGCTGCCGG + Intergenic
1194666851 X:96685200-96685222 CTAAGGCCGGCGGGGGCTGCGGG - Intronic
1195434643 X:104828723-104828745 CTGGGGGAGGGGGCGGCTGTGGG - Intronic
1195687987 X:107602685-107602707 CTCAGGGCTGCTGCTGCTGCAGG - Exonic
1197776331 X:130120883-130120905 CGGAACGCGGCGGCGGCGGCGGG + Intergenic
1197952981 X:131917869-131917891 TGGAGGGCGGTGGCAGCTGCTGG - Intergenic
1199699513 X:150365114-150365136 TTGTTGGCGGCGGCGGCGGCGGG - Intronic
1199736867 X:150693540-150693562 CCGGCGGCGGCGGCGGCGGCGGG + Exonic
1200163283 X:154019848-154019870 CTCAGGGCCGCGGCGGGCGCGGG + Exonic
1200292601 X:154886786-154886808 CAGAGGGCGGCGGCGGCGGCCGG - Exonic
1200339445 X:155382526-155382548 CAGAGGGCGGCGGCGGCGGCCGG - Exonic
1200347025 X:155458167-155458189 CAGAGGGCGGCGGCGGCGGCCGG + Exonic
1202584526 Y:26409258-26409280 CTGAGGGTGGCTGAGGCTGGGGG + Intergenic