ID: 918390204

View in Genome Browser
Species Human (GRCh38)
Location 1:184051801-184051823
Sequence CTGGGTCCGGGCGGTGTTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918390198_918390204 -8 Left 918390198 1:184051786-184051808 CCCGGCTGCAGCGGCCTGGGTCC 0: 1
1: 0
2: 2
3: 49
4: 343
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390189_918390204 27 Left 918390189 1:184051751-184051773 CCGGCATGGAGGAGCGCGGCGAT 0: 1
1: 0
2: 1
3: 3
4: 45
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390193_918390204 -2 Left 918390193 1:184051780-184051802 CCGACCCCCGGCTGCAGCGGCCT 0: 1
1: 0
2: 1
3: 48
4: 306
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390196_918390204 -6 Left 918390196 1:184051784-184051806 CCCCCGGCTGCAGCGGCCTGGGT 0: 1
1: 0
2: 3
3: 16
4: 250
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390197_918390204 -7 Left 918390197 1:184051785-184051807 CCCCGGCTGCAGCGGCCTGGGTC 0: 1
1: 0
2: 3
3: 15
4: 208
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390199_918390204 -9 Left 918390199 1:184051787-184051809 CCGGCTGCAGCGGCCTGGGTCCG 0: 1
1: 0
2: 0
3: 9
4: 161
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88
918390191_918390204 3 Left 918390191 1:184051775-184051797 CCGAGCCGACCCCCGGCTGCAGC 0: 1
1: 1
2: 2
3: 16
4: 217
Right 918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918390204 Original CRISPR CTGGGTCCGGGCGGTGTTCG CGG Exonic
900337084 1:2169655-2169677 GTGGGTGCGTGCGGTGTTGGGGG + Intronic
901577310 1:10210963-10210985 CGGGGTCCGGGCGGGGTCTGAGG + Intronic
903768876 1:25751640-25751662 CTGGCTCAGGGAGGTGCTCGGGG - Intronic
918390204 1:184051801-184051823 CTGGGTCCGGGCGGTGTTCGCGG + Exonic
1063161506 10:3421929-3421951 CAGGGTCCGGGCTGTGGACGTGG + Intergenic
1063623100 10:7667009-7667031 CTGGGTCCGTGGGGTGGGCGGGG - Intergenic
1063623108 10:7667020-7667042 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623128 10:7667067-7667089 CTGGGTCCGTGGGGTGGGCGGGG - Intergenic
1063623136 10:7667078-7667100 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623142 10:7667096-7667118 CTGGGTCCGTGGGGTGGGCGGGG - Intergenic
1063623150 10:7667107-7667129 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623175 10:7667165-7667187 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623181 10:7667183-7667205 CTGGGTCCGTGGGGTGGGCGGGG - Intergenic
1063623189 10:7667194-7667216 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623208 10:7667240-7667262 CTGGGTCCGTGGGGTGGGCGGGG - Intergenic
1063623216 10:7667251-7667273 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1071221967 10:83478091-83478113 CTGGGGCAGGGTGGTGTTGGGGG - Intergenic
1072123056 10:92420721-92420743 CTGGGCTCGGGAGGTTTTCGCGG + Intergenic
1075368980 10:121918798-121918820 CTGGGTCGGGGCGGGGGTGGGGG + Intronic
1076294871 10:129376462-129376484 CTGGTCCCGTGCTGTGTTCGAGG - Intergenic
1084185579 11:67469172-67469194 CTGGGGCCGGGCGGCGCTCATGG + Exonic
1085317330 11:75553493-75553515 CTGGGTCCCTGCCTTGTTCGGGG + Intergenic
1089432766 11:118436893-118436915 CCGGTTCCGGGCCGTGTTTGGGG + Exonic
1091086740 11:132728170-132728192 CAGGGTGCGGGCGCTGTCCGGGG - Intronic
1094372754 12:29755859-29755881 CTGGATCAGGGCTGTGTTGGGGG - Exonic
1095752261 12:45726994-45727016 CTGGGAGCGGGCGGTATTCGCGG - Intergenic
1096429987 12:51534904-51534926 CTGGGTCTTGGCAGTGTGCGGGG + Intergenic
1096667134 12:53173392-53173414 CTTGCTCCGGGCCGTGTTTGGGG - Exonic
1101680068 12:106956017-106956039 CTGGGGCCGGGCGGAGTGAGCGG - Exonic
1102287263 12:111668204-111668226 CTGGGTCGGGGCGGGGTGTGGGG + Intronic
1103722482 12:122982148-122982170 GTGGGGCCGGGCGGGGTTCCTGG + Intronic
1105034562 12:132909172-132909194 CTGGGTCCGGGCAGTGGTACGGG + Intronic
1112570421 13:100588710-100588732 CTGAGCCCGGGCGGGGGTCGGGG - Intronic
1113820173 13:113208370-113208392 TGGGGGCCGGGCGGTGTCCGTGG - Intronic
1124008178 15:25811183-25811205 CTGGGTCCGGGCAGTGCCCCTGG - Intronic
1128345363 15:66849595-66849617 CTGGGTCAGGTCGGGGTGCGGGG + Intergenic
1130305360 15:82709505-82709527 CTGGGGCCGGGCGCTGTCCATGG + Intronic
1132805910 16:1775078-1775100 GTGGGGCCGGGCGGTGGTCTCGG - Exonic
1132882476 16:2168548-2168570 CTGGGTCCAGGCAGGGTTTGAGG + Intronic
1133333039 16:4988003-4988025 CTGGGTCCGGGCTGGGTGGGCGG + Intronic
1136620283 16:31423946-31423968 CTGGGTCCGCGAGGTGTGTGGGG + Exonic
1137244333 16:46689883-46689905 CTGGGGCCGGGCGGGGTTTAGGG + Intronic
1141973445 16:87497618-87497640 CCGGGTCTGGACGTTGTTCGGGG - Intergenic
1142509716 17:385947-385969 CCGGGCCCGGGCGCTGCTCGGGG + Intronic
1144719257 17:17456472-17456494 CTGGGTCTGTGTGGCGTTCGCGG + Intergenic
1152197271 17:78925127-78925149 GGGGGTCCGGGCGCTGCTCGCGG + Exonic
1152612549 17:81322853-81322875 CTGGGTCAGGGCCGGATTCGGGG - Intronic
1152626085 17:81388525-81388547 CTGGGTCTGGGAGGTGCTTGGGG + Intergenic
1152782249 17:82231566-82231588 CTGGGGCCGGGAGGTGGTGGGGG - Intronic
1152931569 17:83112856-83112878 CTGGGTCCTGGCGGGGCACGAGG + Intergenic
1153688501 18:7568305-7568327 CTGGGCCCGGCCGCTGCTCGGGG - Intronic
1160548800 18:79680085-79680107 CTCGGTGCTGGCCGTGTTCGAGG + Exonic
1160909431 19:1467974-1467996 CTGGGTCCGGGCGGGCGGCGGGG - Exonic
1161809854 19:6465336-6465358 CTGGGTCGGGGGGGTGTCCTGGG + Intronic
1163392554 19:17039268-17039290 CTGGGTGGGGGCGGTGTCTGTGG - Intergenic
1166150953 19:40875623-40875645 CGGGGTCAGGGCGGGGTTCGCGG - Exonic
1166746783 19:45145550-45145572 CTGAGTCCGGGCTGGGTGCGGGG - Exonic
1168412308 19:56147556-56147578 CTGCGTGCGGGCGGGGTGCGGGG - Intronic
926302861 2:11617001-11617023 CTGAGTCCTGGCCGTGTTAGGGG + Intronic
928093867 2:28392532-28392554 CTGGGCCCGGGGGGTGAGCGGGG + Intronic
929776057 2:44931680-44931702 CGGTGTCCGGGCGGAGTTGGGGG - Intergenic
938544573 2:132316227-132316249 CTTGGTCCTGGCGTTGTGCGGGG - Intergenic
948142443 2:235683851-235683873 CTGGGGCCGGGCGGGGGACGGGG - Intronic
1171942633 20:31346790-31346812 CTGGGCCCGGGAGGTGTAGGGGG - Intergenic
1179878906 21:44285448-44285470 CTGGATCGGGGTGGTGTTCCTGG - Intergenic
1183506986 22:38214830-38214852 CGGGGTCCGGGCCGTGGGCGGGG - Exonic
1183933678 22:41249887-41249909 CTGTGTCTGCGCGGTGTTGGGGG - Intronic
1184979670 22:48086855-48086877 CCGGGTCGGGGCGGGGGTCGGGG + Intergenic
1184979684 22:48086879-48086901 CCGGGTCGGGGCGGGGGTCGGGG + Intergenic
1185232604 22:49691983-49692005 CTGGGTGCTGGCTGTGCTCGAGG - Intergenic
1185322088 22:50206136-50206158 CTGGAACTGGGCGGTGTTGGAGG + Intronic
1185330925 22:50251689-50251711 CCGGCTCAGGGCGGTGGTCGTGG + Intronic
954305635 3:49723942-49723964 CCGGGTCCGGCCTGAGTTCGGGG - Exonic
967067944 3:185937523-185937545 CTGCGTCCCCGCGGTGTTGGGGG - Intronic
977162265 4:93649993-93650015 CTGGGTCAGGGAGGTGGTGGTGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
994692111 5:103032563-103032585 CTGGATCTGGGCAGTGTCCGTGG - Intergenic
999279176 5:150353705-150353727 CTGGTTCCTGGAGGTGTTGGTGG + Intergenic
1006838444 6:37013472-37013494 CTGGGTGTGGGCGGGGTACGGGG - Intronic
1014797910 6:125747861-125747883 CTGGGTCGGCGCGGGGTTCGGGG - Intronic
1019547437 7:1585318-1585340 CTGGGTCAGGACGGAGGTCGGGG - Intergenic
1019681952 7:2355278-2355300 CCGGGCCCAGGCGGTGTCCGAGG + Exonic
1034219281 7:149431704-149431726 CTCGGGCCTGGCGGTGTCCGAGG + Exonic
1034535616 7:151724122-151724144 CTGGGTCCGGGGGGTGCTGGTGG + Intronic
1037116886 8:15237556-15237578 GCGGGTCCGGGCGGGCTTCGCGG - Intronic
1048593733 8:135845130-135845152 CTGGGTCCGGCCTGTGTGCTGGG + Intergenic
1049434017 8:142577929-142577951 CTGGGTCTGGGCGATCTGCGGGG + Intergenic
1049765722 8:144354413-144354435 CTGGGTCCGCGCAGGGCTCGCGG + Intronic
1049769981 8:144375245-144375267 CTGGGTCCAGGCGGCGTTTGAGG + Intronic
1062141580 9:134961924-134961946 GTGGCTCCGGGCTGTGATCGTGG - Intergenic
1062320402 9:135988020-135988042 CTGGGGCCGGGCGGAGCGCGGGG + Intergenic
1189655853 X:43244423-43244445 CTGGGTCAGGGAGGTGGTGGTGG + Intergenic
1198229993 X:134679863-134679885 CTGGGTCCGTTTGGTGTTGGCGG + Intronic
1199649601 X:149939214-149939236 GTGGGGCGGGGCGGGGTTCGGGG + Intergenic