ID: 918393151

View in Genome Browser
Species Human (GRCh38)
Location 1:184087553-184087575
Sequence TTCTATGTGTAGAACGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918393148_918393151 2 Left 918393148 1:184087528-184087550 CCTGGTTTAGAAGTCACTCTCAC No data
Right 918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG No data
918393147_918393151 15 Left 918393147 1:184087515-184087537 CCATGATCAGACTCCTGGTTTAG No data
Right 918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918393151 Original CRISPR TTCTATGTGTAGAACGTGGA GGG Intergenic
No off target data available for this crispr