ID: 918399281

View in Genome Browser
Species Human (GRCh38)
Location 1:184147375-184147397
Sequence CCCTGTGCTCACCCATGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918399281_918399287 -8 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399287 1:184147390-184147412 GCACAGGGCCAGGTGGAGGATGG No data
918399281_918399290 11 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399290 1:184147409-184147431 ATGGATTCCTCCATGTGGTTCGG No data
918399281_918399291 12 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399291 1:184147410-184147432 TGGATTCCTCCATGTGGTTCGGG No data
918399281_918399289 6 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399289 1:184147404-184147426 GGAGGATGGATTCCTCCATGTGG No data
918399281_918399292 17 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399292 1:184147415-184147437 TCCTCCATGTGGTTCGGGAGTGG No data
918399281_918399295 19 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399295 1:184147417-184147439 CTCCATGTGGTTCGGGAGTGGGG No data
918399281_918399294 18 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399294 1:184147416-184147438 CCTCCATGTGGTTCGGGAGTGGG No data
918399281_918399297 25 Left 918399281 1:184147375-184147397 CCCAAGCATGGGTGAGCACAGGG No data
Right 918399297 1:184147423-184147445 GTGGTTCGGGAGTGGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918399281 Original CRISPR CCCTGTGCTCACCCATGCTT GGG (reversed) Intergenic
No off target data available for this crispr