ID: 918400296

View in Genome Browser
Species Human (GRCh38)
Location 1:184156257-184156279
Sequence GGGGACAAGACAGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918400296_918400305 2 Left 918400296 1:184156257-184156279 CCCACAAAGGCTGTCTTGTCCCC No data
Right 918400305 1:184156282-184156304 GCAAGAAGGAGGTTTGTTTTGGG 0: 55
1: 131
2: 293
3: 354
4: 555
918400296_918400300 -9 Left 918400296 1:184156257-184156279 CCCACAAAGGCTGTCTTGTCCCC No data
Right 918400300 1:184156271-184156293 CTTGTCCCCAGGCAAGAAGGAGG 0: 8
1: 232
2: 350
3: 299
4: 380
918400296_918400306 7 Left 918400296 1:184156257-184156279 CCCACAAAGGCTGTCTTGTCCCC No data
Right 918400306 1:184156287-184156309 AAGGAGGTTTGTTTTGGGAAAGG 0: 79
1: 171
2: 346
3: 323
4: 631
918400296_918400307 8 Left 918400296 1:184156257-184156279 CCCACAAAGGCTGTCTTGTCCCC No data
Right 918400307 1:184156288-184156310 AGGAGGTTTGTTTTGGGAAAGGG 0: 71
1: 136
2: 304
3: 300
4: 618
918400296_918400304 1 Left 918400296 1:184156257-184156279 CCCACAAAGGCTGTCTTGTCCCC No data
Right 918400304 1:184156281-184156303 GGCAAGAAGGAGGTTTGTTTTGG 0: 55
1: 140
2: 284
3: 338
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918400296 Original CRISPR GGGGACAAGACAGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr