ID: 918403316

View in Genome Browser
Species Human (GRCh38)
Location 1:184186772-184186794
Sequence AATTGAAAGCAGAATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918403314_918403316 -6 Left 918403314 1:184186755-184186777 CCAGAAGTGAAAATTATAATTGA No data
Right 918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918403316 Original CRISPR AATTGAAAGCAGAATCTGGA TGG Intergenic
No off target data available for this crispr