ID: 918406801

View in Genome Browser
Species Human (GRCh38)
Location 1:184219502-184219524
Sequence ATTTGGGCAGAATCTCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918406796_918406801 26 Left 918406796 1:184219453-184219475 CCTGAAGGTATATAATGAGGAAA No data
Right 918406801 1:184219502-184219524 ATTTGGGCAGAATCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918406801 Original CRISPR ATTTGGGCAGAATCTCTGGA GGG Intergenic
No off target data available for this crispr