ID: 918409736

View in Genome Browser
Species Human (GRCh38)
Location 1:184245894-184245916
Sequence GTGTTGTGGGATGTGAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918409736_918409742 18 Left 918409736 1:184245894-184245916 CCCATGTTCACATCCCACAACAC No data
Right 918409742 1:184245935-184245957 GTAGATGCTCCATATTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918409736 Original CRISPR GTGTTGTGGGATGTGAACAT GGG (reversed) Intergenic
No off target data available for this crispr