ID: 918410154

View in Genome Browser
Species Human (GRCh38)
Location 1:184249912-184249934
Sequence CCAAACCTGCACAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918410146_918410154 16 Left 918410146 1:184249873-184249895 CCTTCTACCCTTTGATCTCCTTC No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data
918410150_918410154 -2 Left 918410150 1:184249891-184249913 CCTTCCAGTGCTGTCGATTGGCC No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data
918410148_918410154 8 Left 918410148 1:184249881-184249903 CCTTTGATCTCCTTCCAGTGCTG No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data
918410147_918410154 9 Left 918410147 1:184249880-184249902 CCCTTTGATCTCCTTCCAGTGCT No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data
918410151_918410154 -6 Left 918410151 1:184249895-184249917 CCAGTGCTGTCGATTGGCCAAAC No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data
918410145_918410154 27 Left 918410145 1:184249862-184249884 CCTGAATCTCTCCTTCTACCCTT No data
Right 918410154 1:184249912-184249934 CCAAACCTGCACAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918410154 Original CRISPR CCAAACCTGCACAAGGCAGA AGG Intergenic
No off target data available for this crispr