ID: 918413567

View in Genome Browser
Species Human (GRCh38)
Location 1:184285199-184285221
Sequence GTCCCTTTCTTTACTATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918413567_918413575 25 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413575 1:184285247-184285269 CTGGGACAGGGTATGAAGTGTGG No data
918413567_918413573 12 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413573 1:184285234-184285256 TTTTGGGTGACGACTGGGACAGG No data
918413567_918413570 -4 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413570 1:184285218-184285240 GGACATTTGCAGGCAGTTTTGGG No data
918413567_918413572 7 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413572 1:184285229-184285251 GGCAGTTTTGGGTGACGACTGGG No data
918413567_918413571 6 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413571 1:184285228-184285250 AGGCAGTTTTGGGTGACGACTGG No data
918413567_918413574 13 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413574 1:184285235-184285257 TTTGGGTGACGACTGGGACAGGG No data
918413567_918413569 -5 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413569 1:184285217-184285239 GGGACATTTGCAGGCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918413567 Original CRISPR GTCCCTTTCTTTACTATTGC AGG (reversed) Intergenic
No off target data available for this crispr