ID: 918413569

View in Genome Browser
Species Human (GRCh38)
Location 1:184285217-184285239
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918413567_918413569 -5 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413569 1:184285217-184285239 GGGACATTTGCAGGCAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr