ID: 918413570

View in Genome Browser
Species Human (GRCh38)
Location 1:184285218-184285240
Sequence GGACATTTGCAGGCAGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918413567_918413570 -4 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413570 1:184285218-184285240 GGACATTTGCAGGCAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918413570 Original CRISPR GGACATTTGCAGGCAGTTTT GGG Intergenic
No off target data available for this crispr