ID: 918413575

View in Genome Browser
Species Human (GRCh38)
Location 1:184285247-184285269
Sequence CTGGGACAGGGTATGAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918413567_918413575 25 Left 918413567 1:184285199-184285221 CCTGCAATAGTAAAGAAAGGGAC No data
Right 918413575 1:184285247-184285269 CTGGGACAGGGTATGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918413575 Original CRISPR CTGGGACAGGGTATGAAGTG TGG Intergenic
No off target data available for this crispr