ID: 918414678

View in Genome Browser
Species Human (GRCh38)
Location 1:184294384-184294406
Sequence ATGGCAATCCTGGCACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918414674_918414678 18 Left 918414674 1:184294343-184294365 CCTGTAGCATCTCGCAAAGGTTC No data
Right 918414678 1:184294384-184294406 ATGGCAATCCTGGCACATGGAGG No data
918414673_918414678 19 Left 918414673 1:184294342-184294364 CCCTGTAGCATCTCGCAAAGGTT No data
Right 918414678 1:184294384-184294406 ATGGCAATCCTGGCACATGGAGG No data
918414672_918414678 20 Left 918414672 1:184294341-184294363 CCCCTGTAGCATCTCGCAAAGGT No data
Right 918414678 1:184294384-184294406 ATGGCAATCCTGGCACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918414678 Original CRISPR ATGGCAATCCTGGCACATGG AGG Intergenic
No off target data available for this crispr