ID: 918426165

View in Genome Browser
Species Human (GRCh38)
Location 1:184412209-184412231
Sequence GCATTACCACCCCACTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918426164_918426165 8 Left 918426164 1:184412178-184412200 CCAGGTTTAATTTCTACTTAGTG 0: 1
1: 0
2: 1
3: 11
4: 210
Right 918426165 1:184412209-184412231 GCATTACCACCCCACTGTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918426165 Original CRISPR GCATTACCACCCCACTGTTA AGG Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
910137846 1:83994146-83994168 GGATTCCCACCCCACTTTTCAGG - Intronic
910147982 1:84105300-84105322 TCATTTCCACCCCCTTGTTATGG + Intronic
915284839 1:154846027-154846049 GCTGTGCCACCCCACTGTTTTGG - Intronic
918426165 1:184412209-184412231 GCATTACCACCCCACTGTTAAGG + Intronic
1072798416 10:98374473-98374495 GGGTTACCTACCCACTGTTAAGG - Intergenic
1073433416 10:103501439-103501461 GCATTTCCAACCCACAGCTATGG + Intronic
1078739856 11:14056152-14056174 ATATTACCACCCCCATGTTATGG - Intronic
1078884904 11:15490321-15490343 GTATTATCTCCCCACTTTTATGG + Intergenic
1080651374 11:34225337-34225359 GCAAGACCCCGCCACTGTTATGG + Intronic
1082009502 11:47440890-47440912 CCATGTCCAGCCCACTGTTAGGG + Intronic
1092210512 12:6643365-6643387 GCATTACCAGTCCACTTTAAAGG - Intronic
1104229465 12:126870464-126870486 ACATTTCCACCCCACCGTTTTGG + Intergenic
1105653317 13:22404624-22404646 TCATTACTACCCCACTGAAAGGG + Intergenic
1108710278 13:53026670-53026692 GTATTGCCACCCCTCTGGTAAGG + Intergenic
1109202389 13:59445215-59445237 GAATTATCAGCCCCCTGTTAAGG - Intergenic
1114877674 14:26741826-26741848 GCAATACATCCCCATTGTTATGG - Intergenic
1115068226 14:29291878-29291900 GCAGTACCACCCCACTACTTTGG + Intergenic
1115068347 14:29293203-29293225 GCAGTACCACCCCACTACTTTGG - Intergenic
1117471117 14:56046011-56046033 CCATTTCCACCCCTCTTTTATGG - Intergenic
1120364711 14:83551351-83551373 GAATTACCAAACCACTGTTCAGG + Intergenic
1126257615 15:46646223-46646245 GCATTACCTTCCTAGTGTTATGG + Intergenic
1126611342 15:50532523-50532545 GCCTTACCACCCCATCATTAAGG + Intronic
1144627086 17:16849524-16849546 GCACTACCACCCAACTGTGCCGG - Intergenic
1144879355 17:18423188-18423210 GCACTACCACCCAACTGTGCCGG + Intergenic
1145152885 17:20521199-20521221 GCACTACCACCCAACTGTGCCGG - Intergenic
1166970606 19:46564774-46564796 GCATTTCCACCCCTCTGGTTTGG + Intronic
937517830 2:122675449-122675471 GCATTTCCACACAACTGTCATGG - Intergenic
942372050 2:175295611-175295633 GCATGACTACTCCACTGTCAAGG + Intergenic
945905261 2:215586070-215586092 GCAGTACCTGCCCACTGTGAAGG - Intergenic
1171450181 20:25230195-25230217 GCATTACAAGCACACTGTTATGG - Intergenic
1175321226 20:58089787-58089809 GACTTACCACCCCTCTGTTCAGG + Intergenic
1177054255 21:16280283-16280305 GCATGACTTCCCCACTGTTGGGG + Intergenic
1179720004 21:43310100-43310122 GCCATTCCACCACACTGTTAAGG + Intergenic
952582699 3:34853297-34853319 CCATGATCACCCCATTGTTAGGG - Intergenic
954400933 3:50319216-50319238 CCATTTCCACCCCACTTTTGGGG + Intronic
966081447 3:176007775-176007797 ACATTACCACACCAGTATTAAGG - Intergenic
976513767 4:85940499-85940521 ACATGACCACCCCACTGCAAGGG + Intronic
978200917 4:106022802-106022824 CCACTACCACCCCACAGGTAGGG + Intergenic
979856642 4:125640484-125640506 GGATTCCCACCCCAGAGTTATGG - Intergenic
986494075 5:8323919-8323941 GCATTACCACCACACTAACAGGG + Intergenic
989137298 5:38167879-38167901 GCATAACAACCCAACTGTTTTGG - Intergenic
993369040 5:87069647-87069669 GCATTAACACCCTGATGTTAAGG - Intergenic
1003763224 6:9206302-9206324 GCATTTCCACGCAAATGTTAGGG - Intergenic
1023116928 7:36871920-36871942 TCATCACAACCCCACTCTTAGGG - Intronic
1039217284 8:35286482-35286504 GGATTACCTCTCCACTGCTAGGG - Intronic
1041933254 8:63309809-63309831 CCATTACCATCACACTGTTTAGG + Intergenic
1046100388 8:109607522-109607544 CCCTTACCACACCACTGGTAAGG + Intronic
1048305937 8:133284796-133284818 GCATCACCAACCTTCTGTTAGGG - Intronic
1195169100 X:102248681-102248703 GGATTCCCACCCTAGTGTTATGG + Intergenic
1195189757 X:102438407-102438429 GGATTCCCACCCTAGTGTTATGG - Intronic
1196862428 X:120040769-120040791 GCATCATCATCTCACTGTTAAGG + Intergenic
1196880674 X:120195575-120195597 GCATCATCATCTCACTGTTAAGG - Intergenic
1199814671 X:151386969-151386991 GGTTTCTCACCCCACTGTTATGG + Intergenic