ID: 918426487

View in Genome Browser
Species Human (GRCh38)
Location 1:184415403-184415425
Sequence ATTATCTGTTAGTAAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918426487_918426490 -5 Left 918426487 1:184415403-184415425 CCTGGGTTTTACTAACAGATAAT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 918426490 1:184415421-184415443 ATAATCTGTTCAGTAGGTCTGGG 0: 1
1: 0
2: 3
3: 15
4: 161
918426487_918426489 -6 Left 918426487 1:184415403-184415425 CCTGGGTTTTACTAACAGATAAT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 918426489 1:184415420-184415442 GATAATCTGTTCAGTAGGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 115
918426487_918426491 -1 Left 918426487 1:184415403-184415425 CCTGGGTTTTACTAACAGATAAT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 918426491 1:184415425-184415447 TCTGTTCAGTAGGTCTGGGATGG 0: 1
1: 1
2: 15
3: 82
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918426487 Original CRISPR ATTATCTGTTAGTAAAACCC AGG (reversed) Intronic
900157120 1:1207601-1207623 ATTAGCTGTTTGTGACACCCCGG + Intergenic
901711124 1:11115974-11115996 AATATCTGTTGATAAAAGCCAGG - Intronic
901948970 1:12726221-12726243 ATTCTCTGTTGGGAAAACCTGGG + Exonic
905537133 1:38731036-38731058 CTAATCTGTTAGTAGAACACAGG - Intergenic
905663369 1:39745632-39745654 CTTATCTGTTACTAGATCCCAGG - Intronic
908239792 1:62179163-62179185 AGTATCTATAGGTAAAACCCTGG + Intergenic
911168791 1:94748451-94748473 ATTATCTACAAATAAAACCCAGG - Intergenic
913184805 1:116360599-116360621 ATTATCTGAAAGATAAACCCAGG - Intergenic
914425951 1:147576384-147576406 ATTATTTCTTGGTAAAACACCGG + Intronic
916710452 1:167401264-167401286 ATTATTTATTTTTAAAACCCAGG + Intronic
916938120 1:169652006-169652028 ATTCTCTGTTATTAGAAACCAGG - Intergenic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
918596644 1:186301810-186301832 CTTATATGTTAGTAAAATCAAGG - Intronic
919263141 1:195224247-195224269 AATATCTGTAAGTAAAAACAAGG + Intergenic
920675665 1:208037089-208037111 CTTATCTGTAAGTACAATCCTGG + Intronic
921319652 1:213926374-213926396 TTTAACTGTTATTAAACCCCAGG + Intergenic
922224448 1:223633165-223633187 AATATCAGTTAGAAAAACCTTGG - Intronic
1064069679 10:12217088-12217110 ATTATCAGTAAGAAAAACACTGG + Intronic
1064781528 10:18844435-18844457 TTTATCTGTCTGTATAACCCTGG + Intergenic
1065144420 10:22753985-22754007 ATTATCTATTGGTACAACACAGG - Intergenic
1066059452 10:31708937-31708959 ATTAAGTGTTTGTAGAACCCTGG + Intergenic
1073853344 10:107646568-107646590 ATTTTCTGATAGTAAAACTTAGG + Intergenic
1078595150 11:12679969-12679991 ACTATCTATTAGAAAAACACTGG - Intronic
1080296175 11:30730992-30731014 AAGATGTGTTAGTAAAACCATGG + Intergenic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1087324126 11:96700208-96700230 AGTATCTGTCAGCAAAATCCTGG - Intergenic
1093673539 12:21905785-21905807 AGTAACTGTAATTAAAACCCTGG - Intronic
1097801327 12:63917566-63917588 ATTTTATAGTAGTAAAACCCAGG - Intronic
1098181799 12:67855179-67855201 AGGTTCTGTTAGTGAAACCCTGG - Intergenic
1099333053 12:81316153-81316175 ATTTTTTGTCTGTAAAACCCCGG + Intronic
1101973524 12:109334659-109334681 AATATCTGTAAGTAAAACAAAGG - Intergenic
1102285582 12:111653679-111653701 AATCTCTGTCAGTGAAACCCAGG + Intronic
1103289152 12:119829765-119829787 ATTTTCTGTTAGTAAACACAGGG - Intronic
1105870725 13:24504121-24504143 ATTATTTGATAGTGAAACCATGG + Intronic
1106925110 13:34605607-34605629 ATGATCTAATAGTAAAAACCAGG - Intergenic
1107504605 13:41020612-41020634 ATTAACAGTTTGTAAAACCATGG - Intronic
1111557976 13:89906263-89906285 AAAATCTGTTACTAAAACTCAGG - Intergenic
1111825425 13:93261734-93261756 CTTATCTGTTTGTCCAACCCTGG - Intronic
1111827456 13:93285699-93285721 ATTATATCTTTTTAAAACCCAGG + Intronic
1112834756 13:103500702-103500724 GTTATCTGTGAGGAAAATCCAGG + Intergenic
1113675480 13:112203705-112203727 TTTAGCTGTTAGTTTAACCCAGG - Intergenic
1116259620 14:42607283-42607305 ATTATGTATTAGTGAAACCTGGG - Intergenic
1116300639 14:43177367-43177389 ATTATATGTTAGTGAAACCTAGG + Intergenic
1118574170 14:67224847-67224869 ATTCTTTGTTTATAAAACCCAGG + Intronic
1121904348 14:97726171-97726193 TTTCTCTGTAGGTAAAACCCTGG + Intergenic
1126346780 15:47703966-47703988 ATTATCTGTTGCAAAAACCCAGG + Intronic
1126403495 15:48298975-48298997 ATTTACTGTGAGTAAAACCATGG - Intronic
1126690436 15:51285110-51285132 AGCATCTGTAGGTAAAACCCTGG - Intronic
1128916810 15:71570634-71570656 ATAATCTGGGAGCAAAACCCTGG + Intronic
1129633960 15:77294510-77294532 ATTATCTTTTAGGTAAACCAAGG - Intronic
1131813403 15:96197862-96197884 AATAGCTTTTAGTCAAACCCAGG + Intergenic
1132182247 15:99765884-99765906 AGTATATGTTATTAAAACACTGG + Intergenic
1133261846 16:4556017-4556039 CTTATCTCTTTGTAAAACCTGGG + Intergenic
1136066587 16:27762910-27762932 ATTATCTGTTGGCAAATCCCAGG + Intronic
1137321190 16:47384465-47384487 ATTTTCTGCTAGAATAACCCTGG + Intronic
1139681948 16:68571976-68571998 AATAACTTTTAGTAAAACCCTGG + Intronic
1141801318 16:86311301-86311323 ATCATCTGATAGGAAAACCAAGG - Intergenic
1146104330 17:30018261-30018283 ATGTTCTGTTATTAAAACACTGG + Intronic
1147490995 17:40865947-40865969 ATTATAAGTTACTTAAACCCAGG - Intronic
1148537904 17:48456038-48456060 ATTATCTGTCATTAACACCTTGG - Intergenic
1149788151 17:59453868-59453890 TTTATCAGTTAATACAACCCTGG + Intergenic
1153413189 18:4816743-4816765 ATTATCTTCTTTTAAAACCCAGG - Intergenic
1153413258 18:4817431-4817453 ATTATCTTGTTTTAAAACCCAGG + Intergenic
1156605190 18:38658109-38658131 ATAATCTGAAAGTTAAACCCAGG - Intergenic
1157951615 18:52044337-52044359 ATTAACTGATACTAAAACCAAGG + Intergenic
1159135424 18:64331772-64331794 ATTTTCTGGTACCAAAACCCTGG - Intergenic
1160026138 18:75218090-75218112 ATTAACTGCTACCAAAACCCAGG + Intronic
1162462424 19:10821012-10821034 ATTAGCTGTCAGTAAAGGCCCGG + Intronic
1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG + Intronic
1164178971 19:22803257-22803279 ATTATTTTTTAATAAAACTCTGG - Intergenic
931107833 2:59076693-59076715 CTTAGCTGATAGGAAAACCCTGG + Intergenic
932294659 2:70614340-70614362 ATAAAATGTTAGTAAAACCTAGG - Intronic
933267170 2:80193574-80193596 ATTTTCTGTCTGTAAATCCCAGG + Intronic
934983914 2:98870228-98870250 ATTCTATGTTAGTAAAACTCAGG + Intronic
939642915 2:144662463-144662485 ATTATCTGTATGTAAAACCCAGG + Intergenic
940037003 2:149321513-149321535 ATCATCAGTTAGTGGAACCCAGG - Intergenic
940426026 2:153532823-153532845 GTTATGTGTTAGTAAAAACCTGG - Intergenic
942002425 2:171661978-171662000 ATTCTCTGTAAGAAAAACCTGGG + Intergenic
944978971 2:205092136-205092158 CTTATCTTTTAGTATCACCCTGG - Intronic
945298159 2:208191524-208191546 ATTATCTGTTAATAGGACCAAGG + Intergenic
948966477 2:241385097-241385119 ATCAGCTCTTAGTAAAACACAGG + Intronic
1170540410 20:17381960-17381982 ATTATCTGTGAATAAAACCATGG + Intronic
1172830219 20:37827652-37827674 ATTAACTGTTAGATATACCCGGG + Intronic
1177361742 21:20081780-20081802 ATTATGTATTTATAAAACCCAGG - Intergenic
1177769774 21:25501538-25501560 AATATCTGTTAACAAAACCTGGG + Intergenic
1178011642 21:28293775-28293797 ATTCTCTGTTACTCACACCCAGG + Intergenic
1181624327 22:24113076-24113098 TTAACCTGTTAGTAAAAGCCAGG - Intronic
1184418843 22:44367774-44367796 ATTCTCTGGTAGGAAAAGCCAGG + Intergenic
950761327 3:15231233-15231255 ATTATCTGTTATTAAAACACAGG + Intronic
953783857 3:45895888-45895910 ATTATCTACATGTAAAACCCAGG - Intronic
955994695 3:64667953-64667975 ATAGTCTCTTAGTAAAACACAGG - Intronic
956104479 3:65802608-65802630 ATTATCTGGTAGCAACACTCAGG + Intronic
956481911 3:69681579-69681601 ATCATATGTCAGTAAAATCCAGG + Intergenic
957839957 3:85655113-85655135 ATTTTGTGTTATTAGAACCCTGG - Intronic
961841244 3:129714667-129714689 ATTATCTGTTTGAAAAATCTAGG - Intronic
962714649 3:138115743-138115765 TTAATCCGTTAGTAAAATCCAGG + Intronic
962940224 3:140118705-140118727 AGTATCTGTAATTCAAACCCAGG - Intronic
965021114 3:163232726-163232748 AATTTCTGGGAGTAAAACCCTGG + Intergenic
965021203 3:163234162-163234184 AATTTCTGGGAGTAAAACCCTGG + Intergenic
965507259 3:169530261-169530283 AGAATCTGTGAGTAACACCCAGG - Intronic
966080919 3:175999147-175999169 ATTATCTGATACCAAAACCTGGG + Intergenic
969125311 4:4943537-4943559 ATTATCTTTTTATCAAACCCAGG + Intergenic
970211930 4:13718693-13718715 AATATCACTTAGTAAAACTCAGG + Intergenic
970645161 4:18111539-18111561 ATGATCTGTTTGTACAAGCCTGG + Intergenic
971562014 4:28090568-28090590 ATTATCTGAAAGTTAAACCAAGG - Intergenic
972836955 4:42883036-42883058 ATTATCTGTTTATAACACCTAGG + Intergenic
975063155 4:70029178-70029200 TTTATCTGTTAGTAAAAGAAGGG + Intronic
977928287 4:102726000-102726022 ATTATCTGTAAATAAAAGCCTGG + Intronic
982129437 4:152214640-152214662 ATTATCTCTTTCTAAGACCCTGG + Intergenic
982838076 4:160148013-160148035 ATAATCTCTTAGTGAACCCCAGG - Intergenic
984251203 4:177337337-177337359 ATTATCTTTTACATAAACCCAGG + Intronic
986492680 5:8308280-8308302 GTTATCTGTTAGTTAGAGCCTGG - Intergenic
986986429 5:13505614-13505636 ATTTTCTGTTGGTAACACACTGG - Intergenic
987923087 5:24308772-24308794 AGCATCTATTAGTAAAACCCTGG + Intergenic
993404036 5:87488643-87488665 AGTCTCTGTTGGTAATACCCAGG + Intergenic
995451337 5:112304362-112304384 ATTTTCTGTAAGTCAAACCAAGG + Intronic
998848728 5:146334967-146334989 ATTATCTCTTAGTAAGAACGTGG - Intronic
999921407 5:156325671-156325693 ATTAACTGTCTTTAAAACCCTGG + Intronic
1000640113 5:163691698-163691720 TTTCTCTGGTAGTAAAACCCTGG - Intergenic
1001352634 5:170984268-170984290 ATTATATGTTACTAAACTCCTGG - Intronic
1003576594 6:7302457-7302479 ATTTTCTTTTAATAAAACCTAGG + Intronic
1005332121 6:24760719-24760741 TTTTTCTGTAAGTAATACCCAGG + Intergenic
1006461251 6:34160224-34160246 ATTATATCTTAGTAAAAACCTGG + Intergenic
1010564636 6:77394694-77394716 ATTAGTTGTGAGTAAAACCTTGG - Intergenic
1013713965 6:112935475-112935497 ATTATCTCTTAATTAAACTCAGG + Intergenic
1015965299 6:138692020-138692042 ACGATCCGTTTGTAAAACCCTGG - Intronic
1019845753 7:3499131-3499153 ATTATTTGTTTGGAAAAACCTGG + Intronic
1024365323 7:48513688-48513710 ATTATATTTTAATAAAAGCCTGG + Intronic
1027749953 7:82130707-82130729 ATAATCTTTTAGTTATACCCAGG + Intronic
1028386410 7:90259115-90259137 ACTATCTGTACGTAAAAGCCAGG + Intronic
1028600480 7:92595345-92595367 ATTTTCCGTTTGTAAACCCCAGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1046271935 8:111907645-111907667 ATTTTCTCTTAGTTTAACCCTGG - Intergenic
1051603472 9:18897191-18897213 GACATCTGTTAGTATAACCCAGG - Intronic
1051973155 9:22915242-22915264 TATATCTGTTAGAAAAACACTGG + Intergenic
1058119625 9:101124398-101124420 AGCATCTGTAGGTAAAACCCTGG + Intronic
1059109622 9:111543209-111543231 ATTGTCAGTTACTGAAACCCTGG + Exonic
1187991722 X:24881491-24881513 ATTATCTGTTAGTAAATGGGAGG + Intronic
1188098502 X:26052415-26052437 AAAATGTTTTAGTAAAACCCTGG + Intergenic
1188397221 X:29700096-29700118 ATTATCTCTTAGAAACTCCCAGG + Intronic
1189142829 X:38624813-38624835 ATTATCTGGGGGTGAAACCCAGG - Intronic
1192578100 X:72258793-72258815 ATTATCTGAGAGTAAGACTCAGG + Intronic
1196560973 X:117147873-117147895 AGTAACTGTTTATAAAACCCTGG + Intergenic
1197533206 X:127656330-127656352 TACATCTGTTACTAAAACCCAGG + Intergenic