ID: 918428470

View in Genome Browser
Species Human (GRCh38)
Location 1:184434632-184434654
Sequence AACCCAGTGCTGCCACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918428470_918428474 9 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428474 1:184434664-184434686 ATGATGAGAAGGGTGATGGAAGG 0: 1
1: 0
2: 3
3: 39
4: 431
918428470_918428476 23 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428476 1:184434678-184434700 GATGGAAGGCACCCATGACAGGG 0: 1
1: 0
2: 2
3: 20
4: 154
918428470_918428475 22 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428475 1:184434677-184434699 TGATGGAAGGCACCCATGACAGG 0: 1
1: 0
2: 2
3: 13
4: 107
918428470_918428472 -1 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428472 1:184434654-184434676 TGAGAATTGAATGATGAGAAGGG 0: 1
1: 2
2: 10
3: 59
4: 530
918428470_918428471 -2 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428471 1:184434653-184434675 TTGAGAATTGAATGATGAGAAGG 0: 1
1: 3
2: 18
3: 86
4: 642
918428470_918428473 5 Left 918428470 1:184434632-184434654 CCTGTGAGTGGCAGCACTGGGTT 0: 1
1: 0
2: 2
3: 49
4: 316
Right 918428473 1:184434660-184434682 TTGAATGATGAGAAGGGTGATGG 0: 1
1: 0
2: 2
3: 23
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918428470 Original CRISPR AACCCAGTGCTGCCACTCAC AGG (reversed) Intronic
900469886 1:2848475-2848497 AACCCAGAGCTGCCCCTCCCAGG - Intergenic
901347704 1:8561235-8561257 AGCACAATGCTGCCACTCCCTGG - Intronic
901432860 1:9228130-9228152 AACCCAGTTCTTCCACTCATGGG + Intergenic
901467617 1:9432770-9432792 AACACAGTGCTTCCAGCCACAGG - Intergenic
901830861 1:11891617-11891639 AACTCAGTGCTGCCAGACAGGGG + Intergenic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902451923 1:16501655-16501677 TCCCCAGTGCTGCCGCCCACCGG + Intergenic
902501032 1:16912009-16912031 TCCCCAGTGCTGCCACCCACCGG - Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904280121 1:29413173-29413195 AACCCAGCTCTGCCACTCACAGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904474478 1:30756096-30756118 ACCCCAGCCCTGCCACTAACTGG - Intronic
904551241 1:31320796-31320818 GACCCAGTATTTCCACTCACAGG - Intronic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
907304103 1:53504333-53504355 AACCCAGCTCTACCACTCACAGG + Intergenic
907311554 1:53541775-53541797 AACTCCGTCCTGCCTCTCACAGG - Intronic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
910015420 1:82517752-82517774 GGCCCGGTGCTGCCACTCCCAGG - Intergenic
910734497 1:90437696-90437718 GTCCCAGCTCTGCCACTCACTGG - Intergenic
912415507 1:109505873-109505895 AGCTCAGAGCAGCCACTCACAGG + Exonic
912777638 1:112515804-112515826 GAGCCAGTGCTGGCACTCAGTGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916193702 1:162203668-162203690 ATCCCAGTTCTGCCACTCTTAGG + Intronic
917049521 1:170904094-170904116 GACCCAGAGCTTCCACTAACTGG + Intergenic
917238781 1:172923647-172923669 ATCTCAGTTCTGCCATTCACTGG - Intergenic
918098463 1:181353391-181353413 AACCCAGTGCTGAGAGTCAAGGG + Intergenic
918237774 1:182597241-182597263 ATCCCCATTCTGCCACTCACTGG + Intergenic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
919269132 1:195316076-195316098 AACCCAGCTCTACCACTAACTGG - Intergenic
921174895 1:212585204-212585226 GCCCCAGAGCTGCCACACACAGG - Intronic
922206895 1:223455927-223455949 AGCCCAGCGCTGCTACTTACTGG + Intergenic
1064998273 10:21315198-21315220 ACCCGAGTGCAGCCACCCACGGG - Intergenic
1066756471 10:38717257-38717279 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1067558744 10:47289756-47289778 AAACCTGTGCTGTCACACACTGG - Intergenic
1069636930 10:69930550-69930572 CAGCCAGCCCTGCCACTCACCGG - Exonic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1071983781 10:91030520-91030542 AACCCAGTGCTGTGATTCAGTGG - Intergenic
1073309369 10:102528857-102528879 AACCCAGAGTTGCAACTCAAAGG + Intronic
1074283107 10:112071758-112071780 AATCCAGTTCTGCCATTCACTGG - Intergenic
1075347773 10:121696905-121696927 AACCCAGCTGTGCCACTCACTGG - Intergenic
1076914966 10:133418828-133418850 AGCACAGAGCAGCCACTCACAGG - Intronic
1077115113 11:880604-880626 TACCCACTGCTGCCACCCTCAGG + Intronic
1079017338 11:16880294-16880316 ATCCCAGCTCTGCCACACACTGG + Intronic
1080041123 11:27760445-27760467 AACCCAGTTCTGCCAGACCCTGG - Intergenic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080643781 11:34173789-34173811 AACCCAGGGCTGCCACCAGCAGG + Intronic
1081799504 11:45848016-45848038 GCCCCTGTTCTGCCACTCACTGG - Intronic
1082964792 11:58955975-58955997 AGTCCATTGGTGCCACTCACAGG - Exonic
1083355098 11:62060316-62060338 GTCCCAGTGCTGCCACACAAAGG + Intergenic
1084170288 11:67397608-67397630 GACCCAGTTCTGCCACTGGCTGG - Exonic
1084571770 11:69964025-69964047 AGCCAGGTGCTGCCACTCAAGGG - Intergenic
1084687057 11:70702837-70702859 AACCCAGCTCTGCCACTTACTGG + Intronic
1085294883 11:75425719-75425741 AGCCCAGTGCTGCCACCACCTGG + Intronic
1085996506 11:81921985-81922007 AAGCCTGTTTTGCCACTCACTGG - Intergenic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1086465294 11:87046891-87046913 ATCTCAGTCCTGCCACTTACTGG + Intronic
1086999917 11:93407119-93407141 AACCCAGTGATCCCACTCCTTGG + Intronic
1087203161 11:95366243-95366265 AATCCAGTGCTGGCACTTAATGG + Intergenic
1087633199 11:100674936-100674958 ATGCCAGTGCTGCTACTCCCTGG - Intergenic
1087691145 11:101321530-101321552 AACTCAGTGCTGCCAACAACAGG - Intergenic
1088943323 11:114483232-114483254 ACCCCAGCTCTGCCACTCGCTGG + Intergenic
1089319086 11:117612903-117612925 GTTCCAGTCCTGCCACTCACTGG + Intronic
1089965460 11:122651699-122651721 AACCATGTGCTGCCCCTCTCTGG - Intergenic
1090416931 11:126547151-126547173 AGCCCAGATCTGCCACTAACTGG - Intronic
1091093317 11:132793190-132793212 GACCCAGTGCTGCCCTTCCCGGG + Intronic
1091578658 12:1765050-1765072 AACGCAGTAATTCCACTCACAGG - Intronic
1092126341 12:6077527-6077549 AGCCCAGCTCTGCCACTTACTGG + Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093055007 12:14547299-14547321 CAGCCAGTCCTGCCACACACAGG + Intronic
1093062835 12:14625242-14625264 ATCCCAGCTCTGCCATTCACTGG + Intronic
1094313502 12:29112756-29112778 AACCCACTGCTCCCAGTCACAGG - Intergenic
1097303716 12:58046024-58046046 AACCCGGTTCTGTCACTCACTGG - Intergenic
1099218662 12:79885174-79885196 AATCCAGTTCTGCCATTTACTGG + Intronic
1099935387 12:89119022-89119044 ATCCCAGCTCTGTCACTCACTGG - Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100800366 12:98224408-98224430 GTTCCAGTTCTGCCACTCACTGG - Intergenic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1103170869 12:118818634-118818656 CACCCAGTGCTTCCACTCATGGG + Intergenic
1103602718 12:122064280-122064302 CACCCAGGGCTGACTCTCACTGG - Intergenic
1103913862 12:124366066-124366088 AACCCAGCACTGCCACTCCTAGG + Intronic
1103970988 12:124671315-124671337 ATCCCAGATCTGCCACTCACTGG - Intergenic
1104047603 12:125174122-125174144 ATCCCAGCTCTGCCACTCACTGG - Intergenic
1105837199 13:24222355-24222377 AACCAAGTGCTGGCACACGCAGG - Intronic
1106004194 13:25753242-25753264 AACCAAGTGCTAACACTTACAGG + Intronic
1106443397 13:29801041-29801063 AATGCAGAGCTGCCACCCACTGG - Intronic
1108230254 13:48331463-48331485 AAGCCACTGATGCCACTCTCAGG - Intronic
1108233628 13:48377464-48377486 AACCCAGGGCTGTCACTCCATGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1117326120 14:54670482-54670504 AACCCAGTTCTGCCTCCCCCAGG - Intronic
1117929724 14:60828621-60828643 AACCCAATTCTGACACTAACCGG + Intronic
1119200335 14:72747309-72747331 AACCAATTGCTGCCACCCAGGGG - Intronic
1119206888 14:72801087-72801109 AAGCCAGTCCTGGCATTCACAGG + Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1122153649 14:99737858-99737880 AATATAGCGCTGCCACTCACCGG - Intronic
1122184521 14:99980653-99980675 AACCCAGTGCTGCAAATTGCAGG + Intronic
1123207340 14:106726240-106726262 AAGTCAGTGCTGCCTCTCAGGGG - Intergenic
1123440739 15:20289322-20289344 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1124353513 15:28977960-28977982 ATCCCAGCTCTGCCACTCAGGGG + Intronic
1124808505 15:32910193-32910215 AACCCAGTCCTGTCACTTGCTGG - Intronic
1125102441 15:35930109-35930131 AACCCTGTGCTGCCAAGCTCTGG - Intergenic
1125676551 15:41505230-41505252 AGCCCAGGGCTGCCACTACCTGG - Exonic
1127499876 15:59545634-59545656 ACCCCAGCGCTGCCACCCACTGG - Intergenic
1128114635 15:65097516-65097538 ACCCCAGTGCTGCCATTGACTGG + Intronic
1128359874 15:66954469-66954491 ACCCCAGCTCTGCCACCCACCGG - Intergenic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1129373314 15:75111313-75111335 ACTCCAGCTCTGCCACTCACTGG + Intronic
1131466700 15:92661277-92661299 AAGCCAGTGATGCAACTCACAGG - Intronic
1131875209 15:96798676-96798698 AGCCCAGTCCTGCCACACAATGG + Intergenic
1132040829 15:98523470-98523492 GCCCCAGTGCTGCCCCTTACTGG - Intergenic
1132644306 16:991737-991759 GACCCAGTTCTCCCACTCAGAGG + Intergenic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1133184544 16:4086168-4086190 AATCAAGTGCTGCCAGACACTGG + Intronic
1133229580 16:4360167-4360189 AAACCATTCCTGCCCCTCACTGG - Intronic
1133870659 16:9682620-9682642 ATCCCAGCTCTGCCCCTCACTGG + Intergenic
1134444701 16:14321973-14321995 AACCCAGAGCTTCCAGTCCCTGG + Intergenic
1134790434 16:16984667-16984689 ACCCCAGTTCTGTCACTCACTGG - Intergenic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1136047949 16:27630183-27630205 AACCCTGTTCTGCCACTTTCTGG + Intronic
1136249077 16:28991868-28991890 ATCCCAGGGCTGCTCCTCACTGG - Intergenic
1136251951 16:29011279-29011301 ATCCCAGCGCTGCCACCCAGAGG - Intergenic
1136726115 16:32359068-32359090 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1136844448 16:33565113-33565135 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1138381810 16:56607895-56607917 CACCCTGCTCTGCCACTCACTGG + Intergenic
1140350947 16:74261462-74261484 ATACCAGTTCTTCCACTCACTGG - Intergenic
1140959981 16:79902447-79902469 ATCCAAGGCCTGCCACTCACTGG - Intergenic
1141645471 16:85365080-85365102 ACCCCACAGCTGCCAGTCACTGG - Intergenic
1141681984 16:85550263-85550285 ACCCCAGCTCTGCCACCCACTGG + Intergenic
1141707317 16:85674106-85674128 AGGCCAGGGCTGCCAGTCACTGG + Exonic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1203000316 16_KI270728v1_random:158688-158710 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1203131918 16_KI270728v1_random:1695091-1695113 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1203154615 16_KI270728v1_random:1865412-1865434 AGCCCAGCTCAGCCACTCACAGG + Intergenic
1142674416 17:1504922-1504944 GCCCCAGCTCTGCCACTCACTGG + Intronic
1142982279 17:3679146-3679168 ATCTCAGCGCTGCCATTCACCGG + Intronic
1143944010 17:10573427-10573449 AACCTAGAGCTGCCACGAACTGG - Intergenic
1144671431 17:17134739-17134761 ACCCCCATGCTGCCCCTCACTGG + Intronic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1148777808 17:50105440-50105462 CACCCAGGGCCCCCACTCACTGG - Exonic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1149548075 17:57519073-57519095 CACCCAGTCCTACCTCTCACCGG + Intronic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1151030633 17:70733908-70733930 ATCCCAGTGCTGCTAGTCCCTGG - Intergenic
1151557828 17:74855489-74855511 GTCCCAGTTCTGCCACTAACTGG + Intronic
1151911771 17:77088289-77088311 AACCCAGCTCTGCCACTTCCTGG + Intronic
1152451130 17:80380992-80381014 AACCCAGTGCTGCCAAACAATGG + Intronic
1152741948 17:82022354-82022376 AGCCCAGTGCTGGCGCCCACCGG + Intronic
1153583983 18:6602570-6602592 AAGCCAGGGCTGCCACTCAGGGG + Intergenic
1153873406 18:9342187-9342209 GATCCAGTTCTGCCACTTACTGG + Intronic
1155254070 18:23979365-23979387 ACCCAAGGCCTGCCACTCACTGG - Intergenic
1159462675 18:68740674-68740696 AACCCAGTGCTGCCTCGGACGGG + Intronic
1160116126 18:76081326-76081348 AAGCCAGTGCTCCCAAACACTGG - Intergenic
1161344061 19:3759334-3759356 AACCCAGTGCTGCCAATGGCCGG + Intronic
1162070516 19:8149582-8149604 AGCCCAGAGCTGCCACTCGGGGG + Exonic
1167097392 19:47381657-47381679 CACCCAGGGATGCCACACACTGG + Intronic
1167356240 19:49006017-49006039 ACCCCAGTGCTGCCCAGCACAGG - Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1168097634 19:54124594-54124616 ACCTCAGTGCTGCCCCACACCGG + Exonic
924970316 2:120576-120598 AAGGCAATCCTGCCACTCACAGG + Intergenic
926148611 2:10412000-10412022 AACCCTGTACTGCGACTCAGCGG - Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
927093135 2:19727754-19727776 TACCCGGTTCTGTCACTCACTGG - Intergenic
928589511 2:32799975-32799997 AGCCCATTTCTGCCAGTCACTGG + Intronic
930024280 2:47020876-47020898 AAGCCAGTGCTGCCCCTGCCCGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
933997071 2:87677838-87677860 CACACAGGGCTGCCATTCACAGG + Intergenic
934319770 2:91961513-91961535 AGCCCAGCTCAGCCACTCACAGG - Intergenic
934738813 2:96704360-96704382 CCCCCATGGCTGCCACTCACCGG - Intergenic
935500964 2:103837977-103837999 ACTCCATTGCTGTCACTCACTGG + Intergenic
936027616 2:109045671-109045693 GACCCAGTGCTGCCACTTCCCGG + Intergenic
936296777 2:111273072-111273094 CACACAGGGCTGCCATTCACAGG - Intergenic
936696769 2:114959587-114959609 AACCCAGTGATTCCACTCCTAGG - Intronic
936932148 2:117801237-117801259 AACCCAGTTCTGGAACCCACAGG + Intergenic
940891805 2:159042598-159042620 AAGCCAGTGCTGCAACTCAGAGG + Intronic
941976364 2:171409574-171409596 CACCCAGTGCTGCCATTCAGTGG - Intronic
945075184 2:206031675-206031697 AATCCAGTCCTGCCTCTCATCGG - Intronic
945583411 2:211626032-211626054 ATGACAGTGTTGCCACTCACAGG + Intronic
946521882 2:220474745-220474767 ATCCCAGTTCTGCCACTAATCGG - Intergenic
947649104 2:231769250-231769272 GTCATAGTGCTGCCACTCACTGG - Intronic
948029186 2:234802412-234802434 GACCCAGTGCTGCAGCTCATGGG + Intergenic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948224981 2:236301975-236301997 AGCCCAGTCCTGCCACCAACAGG - Intergenic
948604963 2:239129188-239129210 AACCCAGGGCCGCCATACACAGG + Intronic
1169064444 20:2686643-2686665 ATCCCATCTCTGCCACTCACTGG - Intergenic
1172742368 20:37179147-37179169 ATCCCAGTCCTCCCGCTCACAGG - Exonic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173538436 20:43833207-43833229 AATCCAGCTCTGCCACTCAATGG + Intergenic
1174072840 20:47910705-47910727 ATCTCAGTTCTGCCACTCACTGG - Intergenic
1174114226 20:48215802-48215824 AGCCCAGTCCTGCCTCTCCCAGG + Intergenic
1174906705 20:54559606-54559628 AACCCACTGCAGCCCCTCATGGG + Intronic
1175389116 20:58615288-58615310 AACAATGTGCTGCCAATCACCGG + Intergenic
1175500582 20:59447503-59447525 ATCCCAGTGCTGCCACTTATTGG + Intergenic
1175765054 20:61586686-61586708 ATACCAGCTCTGCCACTCACTGG - Intronic
1177047961 21:16194520-16194542 AGCCCAGAGCTGCCACCCAGAGG - Intergenic
1177659269 21:24062180-24062202 AACCCAGGGCCTCCACTGACTGG + Intergenic
1177828009 21:26105862-26105884 ACCCCAGTGCTGCAACACAGTGG - Intronic
1178384271 21:32136815-32136837 AACCCAGTGATGCTTCCCACCGG - Intergenic
1178588901 21:33892902-33892924 AAACCACAGCTGCCATTCACGGG + Exonic
1180308021 22:11145557-11145579 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1180546497 22:16507370-16507392 AGCCCAGCTCAGCCACTCACAGG - Intergenic
1181783818 22:25211349-25211371 ATCCCAGTTCTGCCCCTCGCTGG - Intergenic
1181885184 22:26016545-26016567 AACCCAGTATCCCCACTCACTGG - Intronic
1181946695 22:26523529-26523551 GACCCAGTGCTACCACTTAGGGG + Intergenic
1182032844 22:27173697-27173719 ACCCCAGTGCTGTGACTCATGGG - Intergenic
1182212692 22:28690009-28690031 AGCCCAGCTCAGCCACTCACAGG + Intronic
1184230575 22:43156281-43156303 CACCCAGTGTTCCCACTGACAGG - Intronic
1185163678 22:49244678-49244700 ATCCCAGAGCTGCCACACCCAGG + Intergenic
1185261825 22:49870339-49870361 GACCCAGTGATGCCACTACCAGG - Intronic
1185340299 22:50287971-50287993 CACCCAGTGCCGCGACTCCCAGG - Exonic
949405180 3:3706450-3706472 AACCCAGTGCTCCCTCTCCGAGG + Intronic
949561246 3:5204730-5204752 AACCCAGTACTGCCATTCCTGGG - Intronic
950046196 3:9949903-9949925 ACCCCAGAGCTGACAGTCACAGG - Exonic
950160939 3:10760753-10760775 AACATAGTTCTGCCACTCGCTGG + Intergenic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950856278 3:16108573-16108595 AACACAATGCTGCCACTTAATGG + Intergenic
951726095 3:25761683-25761705 AACCCAGTGGTTCCACTCCTAGG + Intronic
952287192 3:31980760-31980782 AACCCAGTGATGCCTCCCAACGG - Intronic
952506031 3:34007512-34007534 ACCCCAGCTCTGCCACTCACTGG - Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
953267612 3:41407741-41407763 AACCTATTGCTAACACTCACTGG + Intronic
954898935 3:54002421-54002443 AACCCAGCTCTGGCACACACTGG + Intergenic
956084055 3:65590989-65591011 AACTCAGTGATGCCACTCTCAGG + Intronic
957672589 3:83324491-83324513 AACTCAGTGCTGCCTGTCATAGG - Intergenic
958657787 3:97025070-97025092 AGCTCAGTTTTGCCACTCACAGG + Intronic
959475262 3:106803304-106803326 AACCCAGATCTGCCACCCACTGG + Intergenic
960703577 3:120460419-120460441 ATAGCAGTGCTGCCACTAACCGG + Intergenic
961743159 3:129046492-129046514 AACCCGGTGGTGCCCCACACTGG - Intergenic
963039787 3:141060469-141060491 ATCCCAGTCCTGCCACTTCCTGG + Intronic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
964832018 3:160894611-160894633 AACTCAGCTCTGCCACTAACTGG - Intronic
965479971 3:169206153-169206175 ATCCCAGTCCTGCCACAGACAGG - Intronic
966420996 3:179733866-179733888 TTCCCAGCTCTGCCACTCACTGG - Intronic
966675861 3:182589166-182589188 AACCCAGCCCTTCCACTCCCAGG + Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966918637 3:184598285-184598307 AATCCAGACCTGCCACTTACAGG + Intronic
967268755 3:187715466-187715488 ACCTCAGTGCTGCCACTAAATGG - Intronic
967953138 3:194856341-194856363 TACCCGGTGCTGCCTCTCTCAGG + Intergenic
968282713 3:197489361-197489383 AACCTACTGCTCCCACTCCCAGG - Intergenic
969079875 4:4610139-4610161 AATCCAGCTCTGCCACTCCCAGG + Intergenic
969391735 4:6895903-6895925 CCCCCACTGCTGCCACTCACAGG + Intergenic
971426618 4:26522188-26522210 ATCCCAGTTCTACCACTCACTGG - Intergenic
972335114 4:38100963-38100985 ATCCCTGGGCTGTCACTCACCGG + Intronic
973532366 4:51845183-51845205 AACCCAGTGCTTACACACACTGG - Intronic
977565642 4:98577737-98577759 AATCCAGTTCTGCTATTCACTGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
981546254 4:145897114-145897136 ATCTCAGTTCTGCCACTAACTGG - Intronic
982060479 4:151599627-151599649 TACTCAGTGCTTCCAGTCACTGG + Intronic
982421662 4:155206338-155206360 AACCCAGTTGTGACACTGACAGG - Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
985834842 5:2262749-2262771 AAACCAGTGGGGCCACTCCCAGG + Intergenic
986265619 5:6187662-6187684 AACCCACTGCTGGCACACAAGGG + Intergenic
986455571 5:7914722-7914744 AATCCAGTGAAGCCACTCATGGG + Intergenic
986546806 5:8906539-8906561 AACCACGTCCTGCCACTAACTGG + Intergenic
986843021 5:11720064-11720086 ATCTCTGTGCTGCCACCCACTGG + Intronic
987369630 5:17181324-17181346 CACCCAGTGCTGACACCCACAGG + Intronic
989506432 5:42231281-42231303 AGCGCAGTGCTGCTACTGACTGG + Intergenic
990722841 5:58717424-58717446 AAGCCTGTCCTGCCACCCACAGG + Intronic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
991492784 5:67199406-67199428 ATCCCAGCTTTGCCACTCACTGG + Intergenic
993634825 5:90331312-90331334 AACCCACTGCTGCCACCACCAGG - Intergenic
994659472 5:102636371-102636393 TTTCCAGTGCTGCCTCTCACAGG - Intergenic
996681526 5:126232532-126232554 AACCCAGTGGTTTTACTCACTGG - Intergenic
996820494 5:127621258-127621280 AACCCATAGAGGCCACTCACAGG - Intergenic
997813464 5:136994357-136994379 ATCCCAGCTTTGCCACTCACTGG + Intronic
998795359 5:145812425-145812447 AATCTGGTGCTGCCACTTACTGG + Intronic
999314361 5:150574532-150574554 ATCCCAGTTCTGCCTCTCCCTGG + Intergenic
1000244442 5:159437674-159437696 AATCCAGCTCTTCCACTCACTGG - Intergenic
1001568739 5:172716671-172716693 AATCCAGACCTGCCACTCACTGG + Intergenic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1002027543 5:176405751-176405773 ATCCCCCTTCTGCCACTCACTGG + Intronic
1002185566 5:177453339-177453361 AACACGATGCTGCCAGTCACTGG - Intronic
1003059091 6:2848702-2848724 ATCCCAGTGCAGCCTCTTACTGG + Intergenic
1004632615 6:17436518-17436540 TACCCAGGACTGCCAATCACAGG + Intronic
1004897575 6:20163560-20163582 ATTCCAGTGTTGCCACTGACTGG - Intronic
1006838614 6:37014312-37014334 ATCCCAGTTCTGCTACTCTCTGG - Intronic
1007398186 6:41589148-41589170 ATCCCAGCTCTGCCACTCACAGG - Intronic
1007754039 6:44087356-44087378 AACCCAGTTTTGCCACTAGCTGG - Intergenic
1007826800 6:44606917-44606939 ATCCCAGCTCTGCCACACACTGG - Intergenic
1008360367 6:50610228-50610250 ATCCTAGTACTACCACTCACTGG + Intergenic
1010804267 6:80216215-80216237 AAGCCAGTGCTGTCCCCCACTGG - Intronic
1011673766 6:89710751-89710773 AAGCCAGTGCTGCATCTCTCAGG - Exonic
1013019444 6:106197940-106197962 AAGCCAGTGCTGCCACGGACAGG + Intronic
1013115637 6:107101877-107101899 AACCCATTCCTGCCAATCAAGGG + Intronic
1013317849 6:108958910-108958932 AACCCTGTGCTTCCACTCACTGG - Intronic
1014964142 6:127725868-127725890 AACCAAGTCCTGCCAAACACAGG - Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1016370333 6:143366901-143366923 TTCCCAGTTCTGCCATTCACTGG + Intergenic
1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG + Intronic
1018027041 6:159814706-159814728 ATCCCAGCTTTGCCACTCACTGG + Intronic
1018872616 6:167795244-167795266 CACCCAGGGCCGCCATTCACGGG + Intronic
1019818288 7:3217667-3217689 AATCCAGCTCTGCCACTGACTGG + Intergenic
1022592513 7:31679163-31679185 AATCCAGAGCTGCCACTTCCAGG + Intergenic
1022617948 7:31951771-31951793 AACCCAGTTCTCCCACACACCGG - Intronic
1022763323 7:33381002-33381024 CACCGAGTTCTGCAACTCACAGG + Intronic
1022813898 7:33895469-33895491 GTCCCAGTGCTGCCACCTACAGG + Intergenic
1023277450 7:38535203-38535225 ATCCCAGTCCCGCCCCTCACAGG + Intronic
1024109393 7:46130018-46130040 CAGCCAGTGCTGCCATCCACAGG - Intergenic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1025021150 7:55481206-55481228 ACTCCCCTGCTGCCACTCACTGG - Intronic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1026463215 7:70632579-70632601 AACTCCCTGCTGCCACTCTCTGG + Intronic
1032402339 7:131632474-131632496 ATGCCAGTTCTGCCACTGACTGG - Intergenic
1032489420 7:132312981-132313003 ATCTCAGTGCAGCGACTCACAGG - Intronic
1033442659 7:141394422-141394444 AGCCCAGCTCTGCCAGTCACTGG + Intronic
1033670346 7:143486692-143486714 GACCCAGTGCTTCCACTCCTGGG + Intergenic
1034201783 7:149287265-149287287 ATCCCAGCTCTACCACTCACTGG - Intronic
1034560448 7:151876487-151876509 GACCGAGTGCTGGGACTCACCGG + Exonic
1035737936 8:1902376-1902398 GACGCACTGCTGCCAATCACAGG - Intronic
1037537211 8:19835845-19835867 AACCCTGAGCAGCCACACACAGG + Intronic
1037750103 8:21676065-21676087 ATCCCAGATCTGCCACTAACTGG + Intergenic
1037785221 8:21898932-21898954 ATCCCAGGTCTGCCACTAACTGG - Intergenic
1039219684 8:35315785-35315807 ATGCCAGTCCTGCCACTTACTGG - Intronic
1040275989 8:46013898-46013920 AAGCCAGGGAAGCCACTCACCGG + Intergenic
1040688935 8:49910953-49910975 AGCTCAGCGCTGACACTCACAGG + Intronic
1041628808 8:60061729-60061751 TACCCAGTGCTTGGACTCACTGG - Intergenic
1042188744 8:66164500-66164522 AAGCCAGTGCTGGAAGTCACTGG - Intronic
1042835705 8:73077583-73077605 AGCACAGTGCTGGCACACACAGG + Intronic
1044103332 8:88169466-88169488 AACCCAGCTCTGCCACTTAGAGG - Intronic
1045790010 8:105972536-105972558 GACTCAGGGCTGCCACACACGGG - Intergenic
1047796848 8:128266288-128266310 TATCCCGTTCTGCCACTCACTGG - Intergenic
1047857817 8:128931602-128931624 AGCCCAGAGTTGCCGCTCACAGG + Intergenic
1048333492 8:133486635-133486657 ACCCCAGTCCTGCCATTGACAGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1056020194 9:82432177-82432199 CACCCAGAGCTGCCAGCCACAGG - Intergenic
1056215288 9:84400632-84400654 AACCCTGTGCTGCAAGCCACAGG - Intergenic
1056437844 9:86590378-86590400 AACACATTGCTACCATTCACTGG + Intergenic
1056572252 9:87825865-87825887 CACCCAGAGCTGCCAGCCACAGG + Intergenic
1056722637 9:89084886-89084908 AACCCAGTCCAGCCCCTCATGGG - Intronic
1057574767 9:96233331-96233353 ACGCCAGCTCTGCCACTCACTGG + Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059321419 9:113473335-113473357 ACCCCAGCTCTGCCACTTACTGG + Intronic
1059662865 9:116419087-116419109 GACCCAGTCCTGACACTAACAGG - Intergenic
1059706357 9:116826792-116826814 ACCCCACTGCTGCCACTATCAGG + Intronic
1059861600 9:118469444-118469466 AACTCAGTTCTACCACTAACTGG - Intergenic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1060269185 9:122128905-122128927 AACCCAGCTCTGCCACTTTCTGG + Intergenic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1061303490 9:129719554-129719576 ATCCCAGCCCTGCCACTTACTGG + Intronic
1062025286 9:134337440-134337462 ACCCCAGTGCTGCCACTTGATGG + Intronic
1062209082 9:135353540-135353562 ATCCCAGAGCTGCAACCCACAGG + Intergenic
1062294070 9:135814475-135814497 ATCCCAGTCCTGCCCCTCAGGGG + Intronic
1186505621 X:10089747-10089769 CACCCAGCTCTGCCACTCACTGG - Intronic
1187339712 X:18410220-18410242 AACACACTGCTGCCTCCCACAGG - Intergenic
1188593272 X:31865007-31865029 ATCCCAGTGCTGACACTTACTGG - Intronic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1191682328 X:63853830-63853852 ATCTCAGCTCTGCCACTCACTGG - Intergenic
1193052970 X:77121071-77121093 GTCCCAGTTCTTCCACTCACTGG + Intergenic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1195935629 X:110123494-110123516 AACCAAGATCTGCCAATCACTGG - Intronic
1196007984 X:110855788-110855810 ATCCCAGTCCAGCCACTCCCTGG + Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1197677504 X:129346490-129346512 AACTCAGTGCTGTCTCTTACAGG + Intergenic
1198585451 X:138115802-138115824 GTCACAGTTCTGCCACTCACTGG + Intergenic
1199487336 X:148362520-148362542 AACCAGGTAATGCCACTCACTGG + Intergenic