ID: 918435735 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:184510907-184510929 |
| Sequence | GTAAGTCTGAACCAAGGTGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 125 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 108} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918435731_918435735 | 18 | Left | 918435731 | 1:184510866-184510888 | CCAAAATGGGAGACCAGTCACAA | 0: 1 1: 0 2: 1 3: 14 4: 159 |
||
| Right | 918435735 | 1:184510907-184510929 | GTAAGTCTGAACCAAGGTGTTGG | 0: 1 1: 0 2: 1 3: 15 4: 108 |
||||
| 918435732_918435735 | 5 | Left | 918435732 | 1:184510879-184510901 | CCAGTCACAATAATTTTTTCAAG | 0: 1 1: 0 2: 2 3: 28 4: 388 |
||
| Right | 918435735 | 1:184510907-184510929 | GTAAGTCTGAACCAAGGTGTTGG | 0: 1 1: 0 2: 1 3: 15 4: 108 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918435735 | Original CRISPR | GTAAGTCTGAACCAAGGTGT TGG | Intronic | ||