ID: 918435735

View in Genome Browser
Species Human (GRCh38)
Location 1:184510907-184510929
Sequence GTAAGTCTGAACCAAGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918435731_918435735 18 Left 918435731 1:184510866-184510888 CCAAAATGGGAGACCAGTCACAA 0: 1
1: 0
2: 1
3: 14
4: 159
Right 918435735 1:184510907-184510929 GTAAGTCTGAACCAAGGTGTTGG 0: 1
1: 0
2: 1
3: 15
4: 108
918435732_918435735 5 Left 918435732 1:184510879-184510901 CCAGTCACAATAATTTTTTCAAG 0: 1
1: 0
2: 2
3: 28
4: 388
Right 918435735 1:184510907-184510929 GTAAGTCTGAACCAAGGTGTTGG 0: 1
1: 0
2: 1
3: 15
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918435735 Original CRISPR GTAAGTCTGAACCAAGGTGT TGG Intronic