ID: 918446646

View in Genome Browser
Species Human (GRCh38)
Location 1:184623581-184623603
Sequence CATCCACCCATGACACCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918446646_918446651 4 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446651 1:184623608-184623630 GACTCCAGTGTGCCTGTGAGGGG 0: 1
1: 0
2: 2
3: 20
4: 183
918446646_918446653 8 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446653 1:184623612-184623634 CCAGTGTGCCTGTGAGGGGCTGG 0: 1
1: 1
2: 0
3: 41
4: 381
918446646_918446657 21 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446657 1:184623625-184623647 GAGGGGCTGGGTTAGGCAGTCGG 0: 1
1: 1
2: 5
3: 38
4: 420
918446646_918446649 2 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446649 1:184623606-184623628 TGGACTCCAGTGTGCCTGTGAGG 0: 1
1: 0
2: 0
3: 26
4: 236
918446646_918446654 9 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446654 1:184623613-184623635 CAGTGTGCCTGTGAGGGGCTGGG 0: 1
1: 0
2: 3
3: 30
4: 407
918446646_918446650 3 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446650 1:184623607-184623629 GGACTCCAGTGTGCCTGTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 203
918446646_918446655 14 Left 918446646 1:184623581-184623603 CCTCATGGTGTCATGGGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 918446655 1:184623618-184623640 TGCCTGTGAGGGGCTGGGTTAGG 0: 1
1: 0
2: 3
3: 55
4: 577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918446646 Original CRISPR CATCCACCCATGACACCATG AGG (reversed) Exonic
901814638 1:11787259-11787281 CTTCCACCCATTCCCCCATGTGG - Exonic
903196535 1:21693251-21693273 CATCCACCTTTGATCCCATGAGG - Intronic
903776464 1:25797310-25797332 CATCCACCCATGAGAAGAGGAGG - Intergenic
905799837 1:40836151-40836173 CTTCCACGCATGAGACCGTGGGG + Intronic
906666575 1:47626382-47626404 CATCCATCCATGACACCCCCTGG + Intergenic
907975994 1:59432037-59432059 CATCCACCCAATCCACCAGGAGG + Intronic
913276705 1:117145376-117145398 CAGCAACCCATGGGACCATGTGG - Intronic
913991136 1:143612951-143612973 CATCCTCCAATGACACTATGAGG + Intergenic
915925949 1:160019840-160019862 AATGCATCCATGACCCCATGGGG - Intergenic
916611645 1:166397605-166397627 CATCCATTCATGATGCCATGAGG + Intergenic
918446646 1:184623581-184623603 CATCCACCCATGACACCATGAGG - Exonic
920148885 1:203887532-203887554 CTAGCACCCATGAAACCATGCGG + Intergenic
920845118 1:209587232-209587254 CATTCACCTATGACACCACAAGG + Intronic
922731883 1:227952766-227952788 GATCCACTCAAGTCACCATGTGG + Intergenic
1068839363 10:61592761-61592783 TCTCCACCAGTGACACCATGTGG + Intergenic
1071364433 10:84884219-84884241 CATGCACCAATGGCATCATGGGG - Intergenic
1076510881 10:131012880-131012902 CATCCCCCTGTGACCCCATGTGG + Intergenic
1077364757 11:2157071-2157093 CACCCACCCAGGACACACTGCGG - Intronic
1078800152 11:14635040-14635062 CAGCCAACCAGGAAACCATGAGG - Intronic
1081844082 11:46225929-46225951 AATTCACCCATGAAACCATCTGG - Intergenic
1083479178 11:62932909-62932931 CATCCTCCCATGACCCCAGAAGG - Intergenic
1083657332 11:64235808-64235830 CATCTATCCATGACACCACTGGG - Exonic
1085034573 11:73292340-73292362 CATCTACCCATCCCTCCATGTGG - Intronic
1090856690 11:130614989-130615011 CTTCCACCCATGCCTCTATGCGG - Intergenic
1094330923 12:29292230-29292252 CATCCACCCTTCTCACGATGGGG - Intronic
1099873569 12:88377269-88377291 CATCCTCCCATGACAGAAAGTGG + Intergenic
1102801194 12:115735752-115735774 CATCAACCCATCACTACATGAGG - Intergenic
1103914888 12:124371078-124371100 GATTTACCCATGAAACCATGTGG - Intronic
1103980586 12:124734554-124734576 CATGACCGCATGACACCATGGGG - Intergenic
1104894016 12:132153116-132153138 CATCCACCCAGAACTCCACGCGG - Intergenic
1105612406 13:21980535-21980557 CATCCACACAGGGCACCCTGAGG + Intergenic
1114302614 14:21391961-21391983 CACCCACCCAAGACATCATATGG + Intronic
1115758521 14:36554229-36554251 CATCCACCCAGGATACCACCTGG - Intergenic
1115952532 14:38737309-38737331 CATTCACCCCTGCCACCATAAGG + Intergenic
1118940219 14:70328011-70328033 CATCCACCTAAGACACCAAAAGG + Intronic
1119338519 14:73854823-73854845 CATCCATTCATCACACCAAGAGG - Intronic
1121415764 14:93778276-93778298 CATCCTTCCCTGACACCCTGTGG - Intronic
1122642228 14:103166656-103166678 CATTCTCCCATGTCATCATGGGG - Intergenic
1124504822 15:30263671-30263693 CATCCACACAGGACAACAGGGGG + Intergenic
1124624886 15:31302191-31302213 CACCCTCCCTGGACACCATGAGG + Intergenic
1124738730 15:32274964-32274986 CATCCACACAGGACAACAGGGGG - Intergenic
1125135855 15:36342002-36342024 CATCCTCTATTGACACCATGGGG - Intergenic
1125790821 15:42364541-42364563 CATCCATCCATCTCAGCATGAGG + Intronic
1130878217 15:88032456-88032478 CCTCCACCCAAGCCTCCATGAGG - Intronic
1131257934 15:90873713-90873735 CAACCACCCAAAGCACCATGGGG + Intronic
1133289758 16:4711916-4711938 AATCCTCCCATGAAACCATCTGG - Intronic
1133473261 16:6095961-6095983 CAGCCACCCAGGCCACGATGGGG + Intronic
1144157537 17:12520978-12521000 CTTCCACCCATGACAGCATGTGG + Intergenic
1147954076 17:44122812-44122834 CATCCACCCAAGACAAGAAGGGG + Intronic
1151541141 17:74765056-74765078 CAGCCACCCCTGAAGCCATGTGG + Intronic
1152261881 17:79271809-79271831 CCTACTCCCAGGACACCATGAGG + Intronic
1155522562 18:26683813-26683835 CACACACCCATGACACCCTGAGG - Intergenic
1155549315 18:26948467-26948489 CTGCCACCCCTGACACCCTGAGG - Intronic
1157271963 18:46283100-46283122 CATCCACACATATCTCCATGTGG - Intergenic
1158081630 18:53599282-53599304 CAGGCACCCATTACACTATGAGG + Intergenic
1161451179 19:4346270-4346292 CAGCCACCCATGACACCAGCAGG - Intronic
1162909305 19:13840773-13840795 TGTCCACCCAGGACACCAGGAGG + Intergenic
1163443074 19:17331319-17331341 CCTGCACCCATGACTTCATGAGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165882507 19:39053743-39053765 CATCCACCCCTGTCTCCATCTGG + Intergenic
1165923170 19:39311209-39311231 CCTCCGCCCATGACAGCGTGAGG + Intronic
1166297475 19:41896142-41896164 CATCCACCCAGGACACACAGGGG + Intronic
1166917696 19:46206870-46206892 CATCCACCCATGACAGCGAGTGG + Intergenic
1166919986 19:46222682-46222704 CATCCACCCATGAGAGCGAGTGG + Intergenic
1166932192 19:46308253-46308275 CATCCACCCCTGTGACCAAGAGG + Exonic
928531128 2:32192443-32192465 AATCCCCCCATGACACCTTTGGG + Intronic
930416691 2:51098067-51098089 CCACCATCCATGCCACCATGGGG - Intergenic
933637652 2:84725014-84725036 CAACCACCCAAGACAACGTGGGG - Intronic
937477235 2:122226537-122226559 AATCCACACATGACACCCTAGGG - Intergenic
941089957 2:161163227-161163249 AATTCACTCATGAAACCATGTGG + Intronic
942824075 2:180152789-180152811 TATCCAACCATGACATCATGAGG + Intergenic
944531810 2:200674639-200674661 CCTCCATCCCTGACACCATTGGG - Intronic
944975851 2:205049866-205049888 CATCCACAGAGGACACTATGAGG - Intronic
1170400006 20:15971663-15971685 GGTCCACCTATGGCACCATGTGG + Intronic
1177161846 21:17556251-17556273 CATCCAACCATTACACTACGAGG - Intronic
1178357439 21:31920741-31920763 CATCCACACCTCACAGCATGGGG - Intronic
1182062155 22:27406063-27406085 TGGCCACCCATGTCACCATGGGG - Intergenic
1182806351 22:33073916-33073938 AATCCTCCCATGGCAGCATGAGG + Intergenic
1184656086 22:45942688-45942710 CATCCACGTAGGACCCCATGAGG - Intronic
1184773448 22:46611311-46611333 AATCCATCCATCACACCATATGG - Intronic
1185274593 22:49944845-49944867 CAACCCCCCAGGACATCATGCGG - Intergenic
950420282 3:12894701-12894723 CTACAACGCATGACACCATGTGG - Intergenic
951850010 3:27128885-27128907 CCTCCACCCATGACTCCTTGGGG - Intronic
952820243 3:37480311-37480333 AAGCCACGCAAGACACCATGAGG - Intronic
954136207 3:48583322-48583344 CAGCCTCCCCTAACACCATGGGG + Intronic
958685418 3:97386899-97386921 CATCCAGTCTTAACACCATGTGG + Intronic
961125951 3:124417791-124417813 CATCCTCACATGACCCTATGTGG - Intronic
961370823 3:126429171-126429193 AAGTCACCCATGACACCATGAGG + Intronic
961536526 3:127574020-127574042 CACACACCCATTTCACCATGAGG - Intronic
962445833 3:135463824-135463846 CATCCACACATGACATAAGGGGG - Intergenic
968999317 4:3967313-3967335 CATCATCACATGAGACCATGGGG - Intergenic
975103257 4:70538713-70538735 CATACACACATGAAATCATGTGG - Intergenic
976816652 4:89155926-89155948 CATCCAGCCATTATACAATGTGG + Intergenic
984387600 4:179082733-179082755 AAGCCACCAATGACAGCATGGGG - Intergenic
985765436 5:1777061-1777083 CACCCACCCATGCCTCCGTGGGG + Intergenic
985906603 5:2842546-2842568 CATACACACATGACATCATGGGG - Intergenic
992174847 5:74139803-74139825 CATGCCCCCAAGACACCATGGGG + Intergenic
992293001 5:75299547-75299569 CATGCACCCATGACAGTCTGAGG - Intergenic
998652584 5:144137960-144137982 CATTCAGCCATGACATCATCAGG - Intergenic
999826302 5:155276725-155276747 CATACACCCATGAACACATGGGG - Intergenic
1003190683 6:3871676-3871698 CAGCCATCCCTGACCCCATGTGG - Intergenic
1004280324 6:14274977-14274999 CCTCCACTCCTGACACCACGTGG - Intergenic
1006142020 6:31935300-31935322 CCTTCCCCCATCACACCATGAGG - Intronic
1010986627 6:82432649-82432671 AAGCCACCAAGGACACCATGAGG + Intergenic
1015142030 6:129946129-129946151 CATCCACAAAAGACACCCTGTGG - Intergenic
1018777788 6:167034273-167034295 CTTCCACCTATGGCACCAGGTGG - Intronic
1020061655 7:5157013-5157035 CATCTACCCATCAGACCATCAGG + Intergenic
1020166503 7:5811648-5811670 CATCTACCCATCAGACCATCAGG - Intergenic
1021624490 7:22579432-22579454 CATCCCCTCATCAAACCATGAGG + Intronic
1022182696 7:27937656-27937678 CATCCATCCATAAAACCAAGAGG - Intronic
1023319805 7:38982331-38982353 CATCCATCCATAATACCTTGGGG - Intronic
1024118801 7:46216953-46216975 CATCAACACTGGACACCATGGGG + Intergenic
1027878730 7:83804001-83804023 CCTCAACTCATGACACCAAGGGG - Intergenic
1030640390 7:111998584-111998606 CATACAACCATGACAACATCAGG + Intronic
1031564988 7:123285183-123285205 GATTCCCCCATCACACCATGTGG + Intergenic
1033032513 7:137841173-137841195 CAGCCACCCATCACCCCAAGTGG + Intronic
1036649565 8:10633659-10633681 CATCCACCCAGAGCACCAGGAGG + Intronic
1037873017 8:22517464-22517486 AATTCACCCATGAAACCATCTGG + Intronic
1039012152 8:33105644-33105666 TTTCCACCCATGACTCCAAGTGG + Intergenic
1040293070 8:46135409-46135431 CACCCACCCATGCTACCCTGCGG + Intergenic
1040306389 8:46214076-46214098 CACCCACCCACGACACCCTGCGG - Intergenic
1040315934 8:46260920-46260942 CACCCGCCCATGCCACCCTGCGG - Intergenic
1040335487 8:46413843-46413865 GATCCACCCACGCCACCCTGCGG - Intergenic
1040342183 8:46446664-46446686 CACCCACCCACGACACCCTGGGG + Intergenic
1041958223 8:63580781-63580803 CAGCCAGCCATGCAACCATGAGG + Intergenic
1042001910 8:64133357-64133379 AATGCACCCCTGACAACATGAGG + Intergenic
1042875690 8:73438369-73438391 CATACAGCAATGACACCAAGAGG + Intronic
1043650008 8:82579161-82579183 CATACGCACATGTCACCATGGGG + Intergenic
1045598612 8:103687051-103687073 CATTCACCAATGAAACCATTGGG + Intronic
1048197453 8:132343758-132343780 AAGCCACCCAGGACACCAGGTGG - Intronic
1049811444 8:144575561-144575583 CTTTCTCCCAGGACACCATGTGG - Intronic
1052990853 9:34518732-34518754 AGTACAGCCATGACACCATGAGG + Intronic
1061513375 9:131074271-131074293 CACTCACCCATGCCACAATGTGG - Intronic
1187856371 X:23639674-23639696 AATTCACTCATGAAACCATGTGG - Intergenic
1190246748 X:48696059-48696081 CATCCAGCCATGCCCCCAGGCGG - Intronic
1192588995 X:72344114-72344136 CAGCCACCATTGACACCCTGGGG - Intronic
1194288624 X:92040313-92040335 CATCAAGCCTTGCCACCATGGGG - Intronic
1196157034 X:112441535-112441557 CATACACCCTTGCCAACATGTGG - Intergenic
1199847106 X:151699483-151699505 CATCCACCTGTGCCACCAGGTGG - Intronic
1200095408 X:153657335-153657357 CTTCCACCGATGACACCACTGGG + Intergenic
1200606145 Y:5264878-5264900 CATCAAGCCTTGCCACCATGGGG - Intronic