ID: 918449042

View in Genome Browser
Species Human (GRCh38)
Location 1:184641514-184641536
Sequence GAGGTTAGACAGCCTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918449042_918449050 9 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449050 1:184641546-184641568 CGGGTTTCTCATCTAATAAAGGG No data
918449042_918449046 -10 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449046 1:184641527-184641549 GTCTAACCTCTATGGGCCTCGGG No data
918449042_918449051 10 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449051 1:184641547-184641569 GGGTTTCTCATCTAATAAAGGGG No data
918449042_918449049 8 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449049 1:184641545-184641567 TCGGGTTTCTCATCTAATAAAGG No data
918449042_918449053 15 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449053 1:184641552-184641574 TCTCATCTAATAAAGGGGTTGGG No data
918449042_918449052 14 Left 918449042 1:184641514-184641536 CCTTGATCAGGCTGTCTAACCTC No data
Right 918449052 1:184641551-184641573 TTCTCATCTAATAAAGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918449042 Original CRISPR GAGGTTAGACAGCCTGATCA AGG (reversed) Intergenic
No off target data available for this crispr