ID: 918449745

View in Genome Browser
Species Human (GRCh38)
Location 1:184646991-184647013
Sequence TCAGTCCCACACATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918449745_918449748 -10 Left 918449745 1:184646991-184647013 CCTTTCTCCATGTGTGGGACTGA No data
Right 918449748 1:184647004-184647026 GTGGGACTGAAACTCCAGCAGGG No data
918449745_918449753 28 Left 918449745 1:184646991-184647013 CCTTTCTCCATGTGTGGGACTGA No data
Right 918449753 1:184647042-184647064 TTCAGCCAAGTCCAGCCCCACGG No data
918449745_918449749 -6 Left 918449745 1:184646991-184647013 CCTTTCTCCATGTGTGGGACTGA No data
Right 918449749 1:184647008-184647030 GACTGAAACTCCAGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918449745 Original CRISPR TCAGTCCCACACATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr