ID: 918453912 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:184687646-184687668 |
| Sequence | CAGTGGTTGTAGTGGACAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918453912_918453919 | 23 | Left | 918453912 | 1:184687646-184687668 | CCATTTGTCCACTACAACCACTG | No data | ||
| Right | 918453919 | 1:184687692-184687714 | TCCCAGATCCCTTTGGTAGCTGG | No data | ||||
| 918453912_918453918 | 16 | Left | 918453912 | 1:184687646-184687668 | CCATTTGTCCACTACAACCACTG | No data | ||
| Right | 918453918 | 1:184687685-184687707 | CTTCAACTCCCAGATCCCTTTGG | No data | ||||
| 918453912_918453922 | 27 | Left | 918453912 | 1:184687646-184687668 | CCATTTGTCCACTACAACCACTG | No data | ||
| Right | 918453922 | 1:184687696-184687718 | AGATCCCTTTGGTAGCTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918453912 | Original CRISPR | CAGTGGTTGTAGTGGACAAA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||