ID: 918453912

View in Genome Browser
Species Human (GRCh38)
Location 1:184687646-184687668
Sequence CAGTGGTTGTAGTGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918453912_918453919 23 Left 918453912 1:184687646-184687668 CCATTTGTCCACTACAACCACTG No data
Right 918453919 1:184687692-184687714 TCCCAGATCCCTTTGGTAGCTGG No data
918453912_918453918 16 Left 918453912 1:184687646-184687668 CCATTTGTCCACTACAACCACTG No data
Right 918453918 1:184687685-184687707 CTTCAACTCCCAGATCCCTTTGG No data
918453912_918453922 27 Left 918453912 1:184687646-184687668 CCATTTGTCCACTACAACCACTG No data
Right 918453922 1:184687696-184687718 AGATCCCTTTGGTAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918453912 Original CRISPR CAGTGGTTGTAGTGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr