ID: 918454911

View in Genome Browser
Species Human (GRCh38)
Location 1:184700225-184700247
Sequence ACTTATCAGAAGAAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918454911 Original CRISPR ACTTATCAGAAGAAGAAGAC AGG Intronic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
904170651 1:28590231-28590253 ACTTAGCAGAAGAGGAAGCAGGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909060245 1:70870918-70870940 ACATCTCAGAAGAAGACGACAGG - Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
916218590 1:162420595-162420617 TCTTAACAGTAGAAGAAGAAGGG - Intergenic
917025477 1:170637096-170637118 ACTTTTCAGGAGAAGTAAACTGG + Intergenic
917712921 1:177705422-177705444 AGTTATCAGTAGAATAAGATTGG - Intergenic
918454911 1:184700225-184700247 ACTTATCAGAAGAAGAAGACAGG + Intronic
918872685 1:189997066-189997088 ACTTAACAGAAGAAGAATTTGGG - Intergenic
919098539 1:193065467-193065489 ACTAATAAGCAGAAGTAGACAGG + Intronic
919316471 1:195976867-195976889 CCTAAGCAAAAGAAGAAGACTGG - Intergenic
920935897 1:210434124-210434146 ATTTATCAGAAGTTGAAGAGAGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924305745 1:242687387-242687409 CCTCATCAGAGGAAGAAGAGAGG + Intergenic
1063012758 10:2041426-2041448 CCTTTTCAGATGAAGAAGAGAGG - Intergenic
1064060544 10:12132760-12132782 AGGTATCAGAGGAGGAAGACAGG - Intronic
1064074788 10:12260055-12260077 TCTTATCAGAAGAGGAAATCTGG + Intergenic
1065070969 10:22023271-22023293 AGTCATCAGAAAATGAAGACAGG + Intergenic
1065217253 10:23460959-23460981 ACTTATCTGCATAATAAGACAGG - Intergenic
1065283905 10:24168668-24168690 ACTCCCCAGAAGCAGAAGACAGG + Intronic
1066218458 10:33311641-33311663 AGTTTTCAGAAGAAGAATTCTGG + Intronic
1067804320 10:49382603-49382625 ACCTAAGAGAAGGAGAAGACTGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1070216143 10:74383443-74383465 AATTTTCAGAAGAAGATGAATGG - Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1073657646 10:105434587-105434609 ACACATAGGAAGAAGAAGACTGG + Intergenic
1074138241 10:110646203-110646225 ACTTTTAAGTAGAAGAAAACTGG + Intronic
1074289154 10:112125323-112125345 CCTTATCAGCAGAATGAGACTGG - Intergenic
1075393486 10:122110505-122110527 ACTCATTAGAAGATGAAGTCAGG - Intronic
1075505830 10:123021061-123021083 ACCAAATAGAAGAAGAAGACAGG - Intronic
1076138178 10:128059061-128059083 ACTTTTTAGAATAAAAAGACAGG + Intronic
1078878076 11:15418207-15418229 ACTTCTAAGAAAAAGAAGAATGG - Intergenic
1078885107 11:15492270-15492292 ACTTATCACAAGAATAACCCAGG + Intergenic
1079065694 11:17289346-17289368 TCTTATCAGAAGATGATGACAGG + Intronic
1079529664 11:21435205-21435227 ATTTATCATAAGAATAAGATAGG - Intronic
1079697841 11:23505857-23505879 TTCTATCAGAAGAAGAAGTCTGG + Intergenic
1080245417 11:30174556-30174578 ACTTCTTAGAAGAAGAATACAGG - Intergenic
1080554996 11:33407779-33407801 ACTTTTCAGAACAAGGAGGCAGG - Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1083975559 11:66117007-66117029 ACTAAGCAGGGGAAGAAGACAGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1086823270 11:91462145-91462167 ATTAATCAGAAGAAGATGATGGG + Intergenic
1087386723 11:97480662-97480684 AGTTATCATAGGAAAAAGACAGG + Intergenic
1087621835 11:100551955-100551977 ACTAATCAGAAAGAGAGGACTGG - Intergenic
1087696571 11:101384163-101384185 TCTTATCAGAAGAGGAAAACAGG - Intergenic
1087767421 11:102171188-102171210 ACTTATCAAGAGAATAAAACAGG - Intronic
1088211231 11:107458601-107458623 ATTTACAAGAAGAAGAAGGCTGG + Intergenic
1088487864 11:110358417-110358439 TCTTATCAGTAGAAAAAGAAGGG + Intergenic
1088513822 11:110606138-110606160 ACTTATCAGAACTAGAATCCAGG + Intronic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090446348 11:126768012-126768034 ACATTTCAGAAGCAGAACACAGG - Intronic
1091059215 11:132445795-132445817 ACTTCTCAGCAGAGGAAGCCTGG - Intronic
1091090408 11:132765576-132765598 AGCTATCAGAACAAGAACACTGG + Intronic
1092837890 12:12509006-12509028 AGTTCTCAGAAGATGTAGACTGG + Intronic
1093684752 12:22043700-22043722 ACTAATCCAAAGAAAAAGACAGG + Intergenic
1093851949 12:24050830-24050852 AATAATAAGAAGAAGAAGAATGG - Intergenic
1094238668 12:28197402-28197424 TCTTATCAAAAGAAGAGCACAGG - Intronic
1094790677 12:33910969-33910991 ACACTTCAGAAGAAGAAGAAAGG + Intergenic
1097706331 12:62872342-62872364 ACTAACCAAAAGAACAAGACAGG + Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1097827213 12:64186387-64186409 ATTCTTCAGAAGAAGAAGAATGG + Intronic
1097931808 12:65195515-65195537 ACTCATCAGAAGAGGAAAACAGG - Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098910845 12:76206907-76206929 ACTTATCAAAAGAAACAGGCTGG - Intergenic
1100535245 12:95502671-95502693 AATTTTCAGAAGAAGTAGAAAGG - Intronic
1100895715 12:99180186-99180208 GTTTATAAGAAGAAGAAAACTGG - Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102282307 12:111627977-111627999 AATAATAAGAAGAAGAAGCCAGG - Intergenic
1103059214 12:117845323-117845345 ACTTTTAAGAAGCAGAAGGCAGG - Intronic
1104494265 12:129221950-129221972 ACTTGTCAAAAGAAGCACACAGG - Intronic
1105517895 13:21106665-21106687 AATTTTCAGATGAAGAAGCCAGG - Intergenic
1107219833 13:37969411-37969433 TCTTATTAGTATAAGAAGACAGG - Intergenic
1107264286 13:38533866-38533888 AATGATCAGAAGAAGAAGAAAGG + Intergenic
1107901926 13:45024999-45025021 ACTTATTGCAAGAATAAGACAGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108307209 13:49150057-49150079 ACTAATCAAGAGAAGAAGAAAGG - Intronic
1108398496 13:50014027-50014049 ACTTATCACAAGAAAATGCCAGG - Intronic
1108838821 13:54585717-54585739 ACTAATGATAAGAAGAAGGCAGG - Intergenic
1109468046 13:62764546-62764568 GCTTACCAGAGGATGAAGACTGG + Intergenic
1111820007 13:93201624-93201646 TATTATCAGAAGAAAATGACAGG - Intergenic
1112895498 13:104294739-104294761 ATTTATTACAAGAAGAAGAAAGG + Intergenic
1113859447 13:113471671-113471693 ACTTATAAGACCAAGAAGATTGG + Intronic
1114853848 14:26413719-26413741 TCTTATCAAAAGATGGAGACAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115915431 14:38307424-38307446 ACTAATCAAAAGAAGAAAACAGG + Intergenic
1116008567 14:39324311-39324333 GCTCATTAGAAGAAGAAGGCTGG - Intronic
1116075280 14:40103023-40103045 ACCTTTCAGAAGAAGAACATTGG + Intergenic
1116661987 14:47722041-47722063 TCTTATAAGAAGAAGAAATCTGG + Intergenic
1117226534 14:53666494-53666516 ACTTTTAAGATGAAGATGACTGG - Intergenic
1117510677 14:56448121-56448143 ACTTATCTGAAAAAGAATTCAGG - Intergenic
1119145608 14:72310967-72310989 TCTTGTCAGAATAAGAAAACAGG + Intronic
1120808585 14:88779361-88779383 ACTTATCAGTGGCAGAAGGCAGG - Intronic
1121691739 14:95883118-95883140 CCTTTTCAGATGAAGAACACAGG - Intergenic
1122104343 14:99440945-99440967 ACTTCTCAGAAGACAAAGAAAGG + Intronic
1123672545 15:22674025-22674047 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1124324595 15:28747314-28747336 CCTTATTAGAAGAGAAAGACAGG - Intergenic
1126398261 15:48242370-48242392 TCTTATAAGCAGAAGAGGACTGG - Intronic
1127291988 15:57579416-57579438 ACTTTTCAGATGTAGAAGTCTGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1129706014 15:77795025-77795047 ATTTTTCAGATGAAGAAGCCTGG - Intronic
1131420339 15:92299662-92299684 AAATATCAGAGGAAGCAGACTGG + Intergenic
1131737992 15:95354879-95354901 ACCTACCTGAATAAGAAGACAGG + Intergenic
1133485975 16:6218757-6218779 AAATATCTGAAGAAGGAGACCGG - Intronic
1133563396 16:6970246-6970268 TCTTAACAGAATAAGAAGGCAGG + Intronic
1133888791 16:9858182-9858204 ACTTATCAGAAAATAAATACTGG + Intronic
1135209207 16:20509813-20509835 ACTTATAAAAAGAAGAAATCTGG - Intergenic
1138425368 16:56928645-56928667 ACCCATGAGAAGATGAAGACAGG + Intergenic
1140250858 16:73293113-73293135 ACCTACCAGAAGAGGAACACAGG + Intergenic
1140894973 16:79316967-79316989 ATTTAGCAAAAGAAGAAAACAGG + Intergenic
1143665252 17:8354413-8354435 ACTTGACAGAAGAAGAAGGGAGG + Intergenic
1147559174 17:41498459-41498481 ACTTAGCAGATGAGGAAGTCAGG + Intergenic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1151046892 17:70930769-70930791 CCTGATCAGATGAAAAAGACAGG - Intergenic
1151910043 17:77076492-77076514 ACAAATGAGCAGAAGAAGACAGG + Intergenic
1154290278 18:13100800-13100822 AGTTAGCAGATGAAGAAGACAGG + Intronic
1155325933 18:24664983-24665005 ACTTAGCAGAAGACAAAGTCAGG - Intergenic
1155495492 18:26438049-26438071 AATTAACACAAGTAGAAGACAGG - Intergenic
1155603931 18:27581970-27581992 AACTATCAGTAGAAGAAGCCTGG - Intergenic
1155962436 18:32005910-32005932 TCTTATTAATAGAAGAAGACAGG + Intergenic
1157151248 18:45220961-45220983 CCTTAACAGAAGAAGAAGTTTGG - Intronic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1157727540 18:49976456-49976478 ACTTAACAGAAGGAGAGGATAGG + Intronic
1165522633 19:36326706-36326728 ACTCAACAGAAGAAGAAAACTGG - Intergenic
1166523527 19:43497004-43497026 ACTATTCAGAAGAACATGACAGG + Intronic
1166926168 19:46269934-46269956 ACTTATAAAAACAAGAAGGCCGG - Intergenic
926294266 2:11556888-11556910 AATTATTAGAAAAAGAAAACTGG + Intronic
926994200 2:18716237-18716259 ACTCATCAGAAAAACAAGACTGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
928092124 2:28381420-28381442 ACTTACCTGCACAAGAAGACAGG - Intergenic
928634071 2:33224995-33225017 ACATTTCAGAAAAAGAAGAAAGG - Intronic
928691589 2:33805051-33805073 CCTTACCAGAAGAAGGAGAAAGG + Intergenic
928898325 2:36291163-36291185 AATGACCAGAAGTAGAAGACAGG + Intergenic
929683992 2:44018733-44018755 TCTTATCAATATAAGAAGACAGG - Intergenic
929983633 2:46704274-46704296 ACTGCTCAGAATAGGAAGACTGG - Intronic
932643742 2:73480002-73480024 ACTTAACAGGAGAAAGAGACTGG - Intronic
933063061 2:77762088-77762110 ACTTATCATAAGAGGAGAACTGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933335158 2:80948825-80948847 ATTCATTAGAAGAAGAAAACTGG + Intergenic
933682475 2:85114317-85114339 CCTTATCATCAGAAGAAGATAGG + Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
936021594 2:108999190-108999212 ACTTTTCAGATGAAGAACCCAGG - Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
939552282 2:143629588-143629610 AGTTACCAGAAGAAAAAGATGGG - Intronic
939648266 2:144729210-144729232 AGGTAACAGAAGAAGATGACAGG - Intergenic
939765774 2:146247787-146247809 AATTATCAGAAGAATAACAGGGG + Intergenic
939936404 2:148298650-148298672 CCTTCTGAGAAGAAGAAGAGAGG - Intronic
940450095 2:153826242-153826264 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
940828625 2:158442547-158442569 CCTGATGAGAAGAGGAAGACTGG - Intronic
940938861 2:159533333-159533355 AATTTTCAGAAAAAGAACACTGG + Intronic
941169829 2:162122723-162122745 ACTTACTAGAAGGCGAAGACTGG + Intergenic
942341480 2:174952918-174952940 AGTTATCAGAGAAAGAAGAAGGG + Intronic
943738034 2:191378666-191378688 TCTTATCAATATAAGAAGACAGG - Intronic
943784054 2:191857213-191857235 ACTTTACAGAATAAGAATACTGG + Intergenic
946887458 2:224237096-224237118 CCTTATGAGAAGAGGAAGAGAGG - Intergenic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
1169324989 20:4668407-4668429 CCTTGTAAGAAGAGGAAGACAGG - Intergenic
1169618443 20:7476817-7476839 AATAAGGAGAAGAAGAAGACTGG - Intergenic
1169926586 20:10790589-10790611 AACAAACAGAAGAAGAAGACAGG - Intergenic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170807865 20:19649241-19649263 ACTTATCTCTAGATGAAGACCGG - Intronic
1172563978 20:35913829-35913851 TCTTATCAGAAAAAGAGGAGAGG + Intronic
1173369498 20:42422403-42422425 ACTTTTCAAAAGAAGACAACAGG + Intronic
1174504870 20:51010592-51010614 TCTTATAAGAGGAGGAAGACAGG + Intronic
1177062455 21:16392558-16392580 TCTTATTAACAGAAGAAGACAGG - Intergenic
1177672273 21:24247814-24247836 ACTTATCAGAGCATGAATACTGG - Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178378484 21:32088780-32088802 ACTTATCAGAAGGACAAAGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1182020026 22:27073851-27073873 AATTAAAAGAAGAAGAAGAAAGG - Intergenic
1184745515 22:46453501-46453523 ACTTATCAGATGAAGCTGGCTGG - Intronic
949746624 3:7301409-7301431 ACTTATAAGATGAATAAGAAGGG - Intronic
950403647 3:12790513-12790535 GCTATTCAGAAGAAGAAGAAGGG + Intergenic
951851705 3:27148504-27148526 AATTATAAGAAGAAGAAACCTGG - Intronic
952626267 3:35407837-35407859 AGATTTCAGAAGAACAAGACTGG + Intergenic
953212905 3:40892093-40892115 GCTTATCAGAAAAAGAACATGGG + Intergenic
953834016 3:46327702-46327724 ACTTATTAATATAAGAAGACAGG - Intergenic
955110824 3:55947968-55947990 ACTTATGAAATAAAGAAGACTGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
958824298 3:99011526-99011548 ACTTATCAGGAGAAGAGAATGGG + Intergenic
961841270 3:129714959-129714981 ACTTATCTGAAAAATAATACTGG + Intronic
963033072 3:140998596-140998618 ACTGATAAAAAGAATAAGACAGG + Intergenic
964439720 3:156695133-156695155 ACTTCTCAGAGGAAAAACACAGG - Intronic
965108545 3:164389287-164389309 ACTTATCAGGAGAACAGCACGGG + Intergenic
965199292 3:165635980-165636002 ACTCATCAGGAGAAGAATATTGG + Intergenic
965680532 3:171246924-171246946 AAAGATCAGAAGAATAAGACTGG + Intronic
966317872 3:178669010-178669032 TCTCATAAGAAGCAGAAGACAGG - Intronic
966954030 3:184854767-184854789 AATTATCAGAGGCAGAAGCCAGG - Intronic
967015416 3:185477336-185477358 ACTCCTCAGAAGAGGAAGAAGGG + Exonic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
968226958 3:196978816-196978838 AGTGGTCAGAAGAAGAAAACAGG - Intergenic
970087999 4:12369254-12369276 ACTTATTAATATAAGAAGACAGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971879346 4:32349673-32349695 ACCAATCAGAAGAAGCAGTCAGG - Intergenic
971946450 4:33285207-33285229 ATTCATCAAAAGAAGAAAACAGG + Intergenic
972110516 4:35552733-35552755 ATTTATCAGAAGAAGAAATTAGG - Intergenic
972156996 4:36175717-36175739 ACTTATCAAAAGATGGAGAGGGG + Intronic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
973235115 4:47893068-47893090 ACTTCTCAGATGAAAAACACAGG + Intronic
973342042 4:49015384-49015406 ACTTCTCAACAGCAGAAGACAGG - Intronic
973779991 4:54279399-54279421 ACTTTTCAGAAGACGTAGAATGG - Intronic
974778049 4:66513093-66513115 ACTTATCCGTAGAACAACACAGG - Intergenic
976472515 4:85446220-85446242 AATTTTCAGAACAAGAAAACAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977387149 4:96356164-96356186 TCTTACCAGAAAAAGAAGTCTGG + Intergenic
977450850 4:97195130-97195152 ATGGATCAGATGAAGAAGACTGG + Intronic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
980566304 4:134546886-134546908 AATAATAAGAAGAAGAAGAAAGG + Intergenic
981892621 4:149755974-149755996 ACATAGCAGAATAAGAAGGCTGG + Intergenic
982240149 4:153291996-153292018 ACTTATCCAAATAAGAAGTCTGG - Intronic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984152932 4:176156938-176156960 ACTTATAAGAAGAGGAAATCTGG - Intronic
984331618 4:178327909-178327931 ATTTATGAGAAGAAGAAGATTGG + Intergenic
984601970 4:181738084-181738106 ACTTGTCAGAAGAATAAAGCTGG - Intergenic
986635979 5:9823181-9823203 TCTTATCAAAAGGGGAAGACTGG - Intergenic
987624002 5:20374126-20374148 ATTTATCAGCAGAATAACACGGG - Intronic
987794827 5:22613999-22614021 AAATATGTGAAGAAGAAGACAGG - Intronic
987818074 5:22930002-22930024 AAATATCAGAGGAAGAAGAATGG + Intergenic
988134790 5:27157274-27157296 AGGGCTCAGAAGAAGAAGACAGG + Intergenic
989273861 5:39564112-39564134 CCTTAGCTGAAGATGAAGACTGG + Intergenic
991142423 5:63260194-63260216 ACTCATCAGGAGCAGAACACAGG - Intergenic
991422482 5:66455330-66455352 ACTTAAAAGAAGAAAAAGAGAGG - Intergenic
991479876 5:67066641-67066663 ACTTATAAGAACAAAAATACTGG - Intronic
991485443 5:67130556-67130578 AATTATCAGAAGATAATGACTGG - Intronic
991660162 5:68943035-68943057 TCTTTTTAGAAGAAGAAGAATGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
993461248 5:88185077-88185099 ACTTATTAGAAGAAAAAAGCAGG - Intergenic
993708856 5:91202378-91202400 ACTGATCAAAAAAAGAAAACAGG + Intergenic
993908409 5:93649944-93649966 ACTCTTCAGAAGAATATGACAGG + Intronic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994377956 5:99037197-99037219 ACTAATTAGAAAAAAAAGACAGG + Intergenic
994792341 5:104245422-104245444 AAATATCAAAAGAGGAAGACTGG + Intergenic
994955536 5:106526438-106526460 ACTTTCCACAAGAGGAAGACAGG - Intergenic
995783314 5:115801104-115801126 ATTCATCAGAAGTAGAACACAGG - Intergenic
996030337 5:118697731-118697753 AGTTATAACAAGAATAAGACAGG + Intergenic
996142872 5:119935045-119935067 ACTTATCAGAAAAACAAGGGAGG - Intergenic
996220592 5:120927404-120927426 AATTATCAGAAGAAGAGCATGGG + Intergenic
997096326 5:130917300-130917322 ACTTACTAGAAGAAAAACACTGG + Intergenic
998823845 5:146081515-146081537 ACTGATCAGAAGAAGCAAAAGGG + Exonic
1000765328 5:165282460-165282482 ACTAATAAGAAGAATAACACTGG + Intergenic
1003030215 6:2594893-2594915 ACTCCCCAGAAGAACAAGACAGG + Intergenic
1003379205 6:5607432-5607454 ATTTATGAAAAGAGGAAGACTGG + Intronic
1003720055 6:8692086-8692108 AGGGCTCAGAAGAAGAAGACAGG + Intergenic
1006911882 6:37568722-37568744 TCATCTCAGAATAAGAAGACAGG - Intergenic
1007067512 6:39006814-39006836 ACCTGTCAGAAGAAGATGATAGG - Intronic
1007909480 6:45499237-45499259 ACATCTCAAAGGAAGAAGACAGG - Intronic
1007957743 6:45932756-45932778 ACCTCTTAGAAGGAGAAGACAGG + Intronic
1008533242 6:52484497-52484519 ACTTAGTAGTAGAAGATGACTGG + Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011416422 6:87124456-87124478 ACTTCTCACTAGAAGAAGACGGG - Intergenic
1013164283 6:107575731-107575753 AATAATAAGAAGAAGAAGACAGG + Intronic
1013309836 6:108883120-108883142 ACATAAAAGGAGAAGAAGACAGG + Intronic
1013942407 6:115680652-115680674 AGTTATCAGAAGACCATGACAGG - Intergenic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1016502619 6:144738687-144738709 AAATATCACAAGAAGAGGACAGG - Intronic
1016635660 6:146287260-146287282 AGTTATCAGTAGAATAAGACAGG - Intronic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017233501 6:152096750-152096772 ACTCATCAAAAGAAAAAGACAGG - Intronic
1018063218 6:160106614-160106636 ACTTAACAGAAAGAAAAGACAGG - Intronic
1018497369 6:164362858-164362880 AGTTTTCAGAACAAGAATACAGG + Intergenic
1020589863 7:10121829-10121851 ACTATTCAGAAGAAGGAAACTGG - Intergenic
1020830652 7:13090618-13090640 TTTTATCAAAAGATGAAGACAGG - Intergenic
1020969055 7:14910420-14910442 ACATATTAAAAGAAAAAGACTGG + Intronic
1021174611 7:17436590-17436612 AATTATTAGAAGAAGAGGAGGGG + Intergenic
1021430341 7:20551263-20551285 TCTTATGAGTATAAGAAGACAGG + Intergenic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1022495163 7:30848526-30848548 GCTTATCAGAAAAAGGAGAAAGG - Intronic
1023011888 7:35931185-35931207 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1023227645 7:37987775-37987797 TGTTATTAGAAGAAGAAAACTGG - Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023684086 7:42717302-42717324 ACTTATCACAAGAACAACATGGG - Intergenic
1023877651 7:44296478-44296500 AAATATCAGAAGGAGAAGAAAGG + Intronic
1024079247 7:45842683-45842705 ATTTATCAGAAGAAAGAGAAAGG - Intergenic
1025125533 7:56341266-56341288 ATTTATCAGAAGAAAGAGAAAGG + Intergenic
1026143664 7:67727217-67727239 GCTAATAAGAAGAAGCAGACTGG + Intergenic
1026197587 7:68186219-68186241 AATGATCAGAAGAAGAAACCAGG + Intergenic
1027787935 7:82603873-82603895 ACATATCAGAAGTAGAAAACTGG + Intergenic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028641649 7:93048704-93048726 GCTTCCCAGAAAAAGAAGACAGG + Intergenic
1028979157 7:96947736-96947758 AATTCACAAAAGAAGAAGACAGG + Intergenic
1030128054 7:106173364-106173386 AATTATCATAAAAAGAAAACAGG + Intergenic
1030502616 7:110379114-110379136 ACTTTTCAGAAGAAAAATTCAGG + Intergenic
1030983782 7:116216163-116216185 AGTTCTCAGAAAAAGAACACAGG - Intronic
1030988366 7:116269217-116269239 ACTAAGCAAAAGAAGAAGAAAGG - Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031368261 7:120930537-120930559 CCTTACCAGATGGAGAAGACAGG + Intergenic
1031805246 7:126299982-126300004 ACTGATCAAAAGAAGAAAAGAGG + Intergenic
1033184255 7:139211689-139211711 ACCTATTAAAAGAAAAAGACTGG + Intergenic
1033562708 7:142547724-142547746 ACTTATCAGATTTTGAAGACTGG + Intergenic
1034104802 7:148481281-148481303 AGTAAACAGAAGAAGAACACTGG + Intergenic
1034914747 7:155027658-155027680 ACTGATCAGAGGAAGGACACAGG - Intergenic
1035251584 7:157600879-157600901 GCTTTTCAGAAAAAGAAGAGAGG - Intronic
1035849445 8:2900683-2900705 ACCTAACAGCAGCAGAAGACTGG - Intergenic
1036523266 8:9512068-9512090 ACATGTAAGAAGAAGAAGAATGG - Intergenic
1037381845 8:18293654-18293676 ACTTATCACAAGAACAGGATGGG + Intergenic
1039184710 8:34904349-34904371 AAGTGTCAGAAGAATAAGACAGG + Intergenic
1041334243 8:56761957-56761979 ACTCATCAGAAGCAAGAGACAGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042311110 8:67380170-67380192 ACTGAGCAGAAGAAGCAGGCTGG - Intergenic
1043176698 8:77030350-77030372 ATTTATCATGAGATGAAGACTGG + Intergenic
1043770942 8:84199284-84199306 ATTTCTCAAAAGAAGAAAACAGG - Intronic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1043926047 8:86038172-86038194 ATTTATCAGAAGAGAAAAACGGG - Intronic
1044323742 8:90836352-90836374 AAATATAAGAAGAAGAAAACTGG + Intronic
1044564947 8:93652748-93652770 ACTTATCACAAGAACAGCACAGG - Intergenic
1044898654 8:96920709-96920731 ACTTATCAGAAGAAGAAATTTGG + Intronic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045792759 8:106004346-106004368 AGCTATCAGAAGAAGATGAGGGG + Intergenic
1047605806 8:126473170-126473192 AATAATAAGAAGAAGAAGAAAGG - Intergenic
1048504256 8:135006515-135006537 AATTATCAGAAAAAGAATTCTGG - Intergenic
1049086533 8:140482694-140482716 ACTTATAGGCAGAAGAACACTGG - Intergenic
1049566510 8:143341872-143341894 GCTAATAAGAAGAAGAAGAAGGG - Intronic
1051107714 9:13599033-13599055 GCATTTCAGAAAAAGAAGACAGG + Intergenic
1051814629 9:21091062-21091084 AAATATCAGAAAAAGAAAACAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052507039 9:29369144-29369166 ACTTATCAAAAGAAGAAATAAGG + Intergenic
1052600970 9:30630047-30630069 CCTTATCAGATCAAGAACACCGG + Intergenic
1052649080 9:31276403-31276425 ATTTATCAGCAGATAAAGACAGG + Intergenic
1052732381 9:32304530-32304552 ATTTTTCAGAATAAGAAAACTGG - Intergenic
1052900341 9:33788308-33788330 ACTTTTCAAAAGAAGAAGAGGGG - Intronic
1053466334 9:38311387-38311409 ATTGAGCAGAAGAGGAAGACAGG - Intergenic
1055139788 9:72863219-72863241 ACTTACCAGTAGCAGCAGACAGG + Intergenic
1056034506 9:82589445-82589467 GCCTTTCAGAAGAAGAAGTCAGG + Intergenic
1056400500 9:86222978-86223000 ACATGTCTGAAGTAGAAGACAGG + Intronic
1056849627 9:90071457-90071479 ATTTATAAGAAGAGGAAGAGAGG - Intergenic
1057939471 9:99268654-99268676 ACATATCAGGAAAACAAGACTGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060134127 9:121135235-121135257 ATTTATCAGAAGAACAAAATGGG - Intronic
1185929992 X:4191962-4191984 TCTTATGGGATGAAGAAGACAGG + Intergenic
1186155530 X:6721955-6721977 ACTTAGCAGAATAAGGAGACAGG + Intergenic
1186586104 X:10874777-10874799 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1187345798 X:18462562-18462584 AGTTATGAGAACAAGAAGGCAGG + Intronic
1187897139 X:23992719-23992741 ACTGATAAGAAGAAGAAAAGGGG + Intronic
1188033148 X:25286892-25286914 ACTCTTAAAAAGAAGAAGACTGG - Intergenic
1188814279 X:34692012-34692034 ACCAATCAAAAGAAAAAGACTGG - Intergenic
1190459475 X:50658013-50658035 ACATAGCAGAAGAAGTAGAAGGG - Intronic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191900261 X:66033329-66033351 GCTTATCAGAGGAAGTGGACAGG - Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192250564 X:69409901-69409923 ACTTCTCAGAAGAAGAAACCAGG + Intergenic
1193165159 X:78271892-78271914 ACTTATCTGAAGAAGAGAAAAGG - Exonic
1193463974 X:81824733-81824755 ACTTCTGAGAAGAAGAAAAGAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194163897 X:90489845-90489867 AGTTGACAGAAGAAGAAAACTGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194322619 X:92470254-92470276 ACATATCAGAAAAAGAAAACAGG - Intronic
1194322651 X:92470899-92470921 ACATATCAGAAAAAGAAAACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194960255 X:100226887-100226909 GCTTATCAGATGAGCAAGACAGG + Intergenic
1195326328 X:103761531-103761553 TCTTATCAATATAAGAAGACAGG - Intergenic
1195353716 X:104018546-104018568 AGTGATCACAAGAAGATGACTGG - Intergenic
1196283412 X:113851113-113851135 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197167446 X:123393175-123393197 ACTTATGAAAAGAAGAGGAAGGG + Intronic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1199264647 X:145817091-145817113 ACTAATAAGAGGAAGAAGAAAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200412950 Y:2879216-2879238 ACTTTTCAGAAGCAGCAGAGTGG - Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200630771 Y:5583734-5583756 ACATATCAGAAAAAGAAAACAGG - Intronic
1200630802 Y:5584379-5584401 ACATATCAGAAAAAGCAAACAGG - Intronic
1201208735 Y:11657891-11657913 AGTAATCAGAAGAAAAAGAAAGG + Intergenic
1201377454 Y:13338816-13338838 ACTGATCACAAAGAGAAGACAGG - Intronic
1201378528 Y:13347179-13347201 ACTGATCACAAAGAGAAGACAGG - Intronic