ID: 918465432

View in Genome Browser
Species Human (GRCh38)
Location 1:184817017-184817039
Sequence CAGGGTGAGGGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2593
Summary {0: 1, 1: 1, 2: 13, 3: 184, 4: 2394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918465432 Original CRISPR CAGGGTGAGGGGCAGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr