ID: 918465573

View in Genome Browser
Species Human (GRCh38)
Location 1:184818454-184818476
Sequence ATGAATAGACAGATGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 0, 2: 11, 3: 107, 4: 731}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918465567_918465573 8 Left 918465567 1:184818423-184818445 CCATCAGTAAAACTATCAGATGG 0: 1
1: 0
2: 0
3: 14
4: 180
Right 918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG 0: 1
1: 0
2: 11
3: 107
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918465573 Original CRISPR ATGAATAGACAGATGAATGG TGG Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
900896805 1:5488359-5488381 ATGAATGGATAGATACATGGTGG - Intergenic
900993571 1:6108734-6108756 ATGGAGAGACAGAGGGATGGAGG + Intronic
901006553 1:6174490-6174512 ATGGATAGATGGATGGATGGTGG + Intronic
901006748 1:6175429-6175451 GTGGATAGATGGATGAATGGTGG + Intronic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
901783826 1:11611621-11611643 ATGAATAAAGAAATGAATGCTGG + Intergenic
901940632 1:12658989-12659011 ATGAATAGATGGATGGATGGGGG + Intronic
902233455 1:15042984-15043006 AGGAACAGACAGCTGAATCGAGG - Intronic
902370764 1:16005557-16005579 ATGAATAAACAAATGAATTCAGG + Intronic
902412871 1:16221673-16221695 ATGGATGGATGGATGAATGGGGG + Intergenic
902412887 1:16221773-16221795 ATGAATGGATGGATGAATGGAGG + Intergenic
902670569 1:17970476-17970498 AAAAAAAGACTGATGAATGGAGG - Intergenic
902824795 1:18965628-18965650 ATGAATCCACAGCTGAATGCAGG + Intergenic
903357849 1:22758980-22759002 ATAGATGGACAGATGAATGATGG + Intronic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904917461 1:33980620-33980642 ATGGATGGAAGGATGAATGGAGG - Intronic
907342381 1:53745225-53745247 ATGAATAGGCAAATAAATTGTGG + Intergenic
907688508 1:56638024-56638046 ATGAATACAGAGATGAAAGTGGG - Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908032089 1:60011899-60011921 ATGATTAGACAGATAAGTGATGG + Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909566611 1:77059837-77059859 ATAAATAAACAAATAAATGGAGG - Intronic
910533944 1:88274850-88274872 ATGAATCAACCAATGAATGGAGG + Intergenic
911982018 1:104580139-104580161 TTGAGAAGACAGATGAATGTTGG - Intergenic
912099395 1:106186754-106186776 AAGAATAGAGAGAACAATGGAGG + Intergenic
912620248 1:111149043-111149065 AAGAATAGAGGGTTGAATGGTGG - Intronic
912954296 1:114143723-114143745 TTGAATAGCCACAGGAATGGAGG - Intronic
913429457 1:118774849-118774871 ATGAATAGATAAATGAAATGTGG - Intergenic
913941072 1:125106314-125106336 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
913975939 1:143455475-143455497 ATGTATAGAGAGTAGAATGGTGG + Intergenic
914070336 1:144281097-144281119 ATGTATAGAGAGTAGAATGGTGG + Intergenic
914108819 1:144685257-144685279 ATGTATAGAGAGTAGAATGGTGG - Intergenic
915667321 1:157456914-157456936 ATAGATAGACAGATAAAGGGGGG + Intergenic
916045479 1:160997074-160997096 ATAAATAGACTGGTGGATGGTGG + Exonic
916359183 1:163949016-163949038 ATGATGATACATATGAATGGAGG - Intergenic
916942083 1:169686906-169686928 ATGACTAGACAGAAGATTGTAGG - Intronic
917243184 1:172971809-172971831 ATGGATAAATGGATGAATGGAGG - Intergenic
918300710 1:183201171-183201193 ATGAATAGTCAAAGGAATGATGG + Intronic
918305729 1:183244376-183244398 ATGGATGGAAGGATGAATGGAGG - Exonic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918541301 1:185636109-185636131 ATGAATAGATGGATAAATGGAGG - Intergenic
919019324 1:192084164-192084186 AGGAATAGACAGAGGTGTGGAGG + Intergenic
919062871 1:192656392-192656414 CTAAAGAGACAGCTGAATGGTGG - Intronic
919101641 1:193104253-193104275 ATGAATAGAAACATGCACGGAGG + Intronic
919164848 1:193879587-193879609 ATGAACAGACAAATGTGTGGTGG + Intergenic
919360104 1:196581873-196581895 ATGAATAGACAGATGACAGCTGG + Intronic
919935096 1:202245971-202245993 ATGAATGGATAGATGAAGGGAGG - Intronic
919935125 1:202246062-202246084 ATGAATGGATAGATGAAGGGAGG - Intronic
919935245 1:202246393-202246415 ATGAATGGATAGATGAAGGGAGG - Intronic
920195499 1:204223598-204223620 ATGAACAGGGAGGTGAATGGGGG + Intronic
920700610 1:208215647-208215669 ATGGATGGAGAGATGCATGGAGG + Intronic
920873145 1:209810639-209810661 ATGAATGGGCAGAAGAATGAAGG - Intergenic
920958499 1:210642280-210642302 TTGAATAGATACATGAATTGTGG - Intronic
921707267 1:218337479-218337501 AGGAATTGACAGAAGACTGGTGG - Exonic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
922790949 1:228310722-228310744 ATGAAAAGATAGGTGAATAGTGG - Intronic
922792831 1:228319584-228319606 ATGGATGGATGGATGAATGGTGG - Intronic
922792839 1:228319642-228319664 ATGGATGGATAGATGAATGGTGG - Intronic
922792845 1:228319677-228319699 ATGGATGGATGGATGAATGGTGG - Intronic
922792859 1:228319743-228319765 ATGAATGAATGGATGAATGGTGG - Intronic
922792879 1:228319847-228319869 ATGCATAGATGGATGGATGGTGG - Intronic
923828690 1:237529111-237529133 ATGAATAAATAAAGGAATGGAGG + Intronic
923916299 1:238509878-238509900 ATGAATAGATAGATAGATGATGG - Intergenic
924369374 1:243332056-243332078 ATGAATGGACAGGTGAAGAGGGG + Intronic
924716064 1:246575331-246575353 ATGAATAGATAAATAAAAGGTGG + Intronic
924905439 1:248447051-248447073 ATAAATAGGCAGATAAAGGGGGG + Intergenic
1063234248 10:4096357-4096379 ATGGATGGATAAATGAATGGTGG + Intergenic
1063388394 10:5631809-5631831 ATGAATAGATAGATGACTGATGG + Intergenic
1064106435 10:12504455-12504477 ATGAAAAGGCAGAGGAAGGGTGG - Intronic
1064504675 10:16015729-16015751 AGGAAGAGACAGAGGAAGGGAGG + Intergenic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1067209812 10:44250667-44250689 ATGAATATATAGATAAATGATGG - Intergenic
1068219209 10:54021939-54021961 ATTAATTGACAGATGAATGGTGG + Intronic
1068810275 10:61247882-61247904 ATGGATAGATGGATGGATGGAGG - Intergenic
1069135495 10:64758750-64758772 ATGGATAGAAAGTAGAATGGTGG - Intergenic
1069780624 10:70953172-70953194 ATAAGCAGACAGATGGATGGGGG - Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070763513 10:79042289-79042311 ATGCATAGAAGGATAAATGGAGG + Intergenic
1071164723 10:82792196-82792218 ATGGAGAGACAGATGTTTGGAGG + Intronic
1071587011 10:86833357-86833379 ATGAATAGAGGTAAGAATGGAGG + Intronic
1072689668 10:97563743-97563765 ATGACTAGACAGAAGATAGGAGG + Intronic
1072818150 10:98530145-98530167 ATTTCTAGACAGATGTATGGAGG + Intronic
1073467248 10:103701353-103701375 ATGAATGGATAGATGATGGGTGG - Intronic
1073640750 10:105250256-105250278 AAGTTTTGACAGATGAATGGGGG + Intronic
1073696180 10:105871094-105871116 ATGAAAAGACCAATGAATAGAGG - Intergenic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074840114 10:117342789-117342811 ATGATTAGAAAGATTAATTGTGG - Intronic
1074896304 10:117780496-117780518 ATGGATGGATAGATGGATGGAGG - Intergenic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1076326922 10:129631360-129631382 ATGATGAGACAGAAGAATGAAGG + Intronic
1076553116 10:131299263-131299285 ATGAATAGACAGAAGTTTGCAGG - Intronic
1076564102 10:131386530-131386552 AGGAGAAGAGAGATGAATGGAGG + Intergenic
1076676789 10:132151296-132151318 ATGGATAGATGGATGGATGGAGG - Intronic
1076825105 10:132963279-132963301 GTTGATAGACAGATGGATGGAGG - Intergenic
1077280511 11:1742933-1742955 ATGGATGGATAGATGGATGGAGG + Intronic
1077280548 11:1743097-1743119 ATGGATGGATAGATGGATGGAGG + Intronic
1077280599 11:1743396-1743418 ATGGATAGACGGATGGATGGAGG + Intronic
1077357414 11:2124962-2124984 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357504 11:2125424-2125446 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357521 11:2125513-2125535 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077563269 11:3279419-3279441 ATGCATGGACACATGAGTGGGGG - Intergenic
1077569162 11:3325235-3325257 ATGCATGGACACATGAGTGGGGG - Intergenic
1077821114 11:5741596-5741618 ATGAATGCACAAATGAGTGGGGG + Intronic
1077901205 11:6490472-6490494 GTGAATATATAGATGAATGTGGG - Intronic
1078663910 11:13308858-13308880 ATGAACACACAAATGAATGAAGG - Intronic
1078852990 11:15180724-15180746 ACTAATATGCAGATGAATGGAGG - Intronic
1079704971 11:23604036-23604058 ATGAATAGATAAATGAATGAAGG - Intergenic
1080170659 11:29298073-29298095 ATAAATTGACAGATAAATAGTGG - Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080270922 11:30449918-30449940 ATGACTAGACAGAGGAAAGGGGG - Intronic
1080292390 11:30685374-30685396 ATGATGACAAAGATGAATGGGGG + Intergenic
1080740883 11:35063351-35063373 GTGAATAGACAGAAGACAGGTGG + Intergenic
1080781502 11:35433884-35433906 ATGGATAGACAGATGGGTGGGGG + Intronic
1081834235 11:46140801-46140823 AAGAAAAGACAGATCCATGGAGG - Intergenic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082685760 11:56237233-56237255 ATGATTAGAGAGTAGAATGGTGG + Intergenic
1083634752 11:64114457-64114479 ATGGATAGATGGATGGATGGAGG + Intronic
1083716027 11:64577455-64577477 ATGGGTAGATGGATGAATGGAGG + Intergenic
1084157822 11:67324428-67324450 TTAAATGGAGAGATGAATGGTGG - Intronic
1084609836 11:70195033-70195055 ATGAATGGATGGATGGATGGTGG + Intergenic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1084705135 11:70811707-70811729 ATGGATGGATAAATGAATGGTGG - Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1085020684 11:73204991-73205013 ATGAATGGATAAATGAATGTGGG - Intergenic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085706818 11:78794051-78794073 ATGAGCAGACAGTTGGATGGAGG - Intronic
1086237629 11:84651098-84651120 ATGAATAGATTGATGAATGAAGG - Intronic
1086418141 11:86610203-86610225 ATGACCAGAGAGATGAATAGAGG + Intronic
1086429216 11:86719119-86719141 ATGATTGGACGGATGGATGGTGG - Intergenic
1086641487 11:89162957-89162979 AGGAAAAAACAGATGAATGCTGG + Intergenic
1086661528 11:89425363-89425385 ATGCAAAGACATATGGATGGGGG + Intronic
1087278825 11:96187390-96187412 ATGAATAAACAAAAGAATTGAGG + Intronic
1088024586 11:105162517-105162539 AGGAGTAGACAGAAAAATGGTGG - Intergenic
1088323368 11:108576191-108576213 ATGAATAGATAAATAAATTGTGG + Intronic
1088834590 11:113567171-113567193 ATGAGGAGACAGATGAGTGAGGG - Intergenic
1089580064 11:119476143-119476165 ACGAATAGATGGATGAATGATGG + Intergenic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089710556 11:120311454-120311476 ATGAATGGAAAGCTGGATGGGGG + Intronic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1089906976 11:122050009-122050031 ATGAATGGACAAATGAAATGTGG - Intergenic
1090030179 11:123199535-123199557 AAGAATAGAAAGATGGATGGAGG - Intergenic
1090178042 11:124669236-124669258 ATGAATGGACAGACGGATGTAGG + Intronic
1090289505 11:125529671-125529693 ATGAATAGAGAGATGAAATGTGG - Intergenic
1090374318 11:126278127-126278149 AAGAAGAGACAGAAGACTGGAGG - Intronic
1091156015 11:133374120-133374142 GTGAGTGGACAGATAAATGGAGG + Intronic
1091668071 12:2433452-2433474 ATGGGTGGATAGATGAATGGAGG - Intronic
1092165104 12:6337497-6337519 ATGAACAGACACATGAATGAGGG - Intronic
1092368320 12:7895492-7895514 CTGAATAGGCAGATCCATGGAGG - Intergenic
1093750156 12:22789091-22789113 GTAAATAGACAGATAAATCGTGG - Intergenic
1094008571 12:25782367-25782389 CAGACTAGATAGATGAATGGAGG - Intergenic
1094404621 12:30103235-30103257 AGAAATAGACAGTGGAATGGTGG - Intergenic
1095045321 12:37497124-37497146 ATAAATCAACAGCTGAATGGTGG + Intergenic
1095088104 12:38080107-38080129 ATGAGAAGAAAGATGAATGCTGG + Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1095608921 12:44104273-44104295 AAGAATGGAGAGATGAAGGGAGG - Intronic
1096806700 12:54145375-54145397 AGGGACAGACAGATGGATGGAGG + Intergenic
1098449660 12:70605389-70605411 ATGGAAAGATGGATGAATGGTGG - Intronic
1098739557 12:74155180-74155202 ATGAACAGAAAAATGAATGAGGG - Intergenic
1099217355 12:79869198-79869220 GTGAATAGGTAGATGAATGATGG - Intronic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1100098433 12:91072602-91072624 ATCAATTGACAAATGGATGGAGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100625693 12:96329098-96329120 ATTCATAGACAGTAGAATGGTGG + Intronic
1100744973 12:97635648-97635670 ATGAATAGATGGAAGAATGGAGG - Intergenic
1100956018 12:99909269-99909291 ATGAATGGATAGAGAAATGGTGG - Intronic
1101318762 12:103653872-103653894 ATGGATGGAGAGATGCATGGAGG + Intronic
1101547442 12:105729450-105729472 ATAAATAGGCAGTTGAAAGGTGG + Intergenic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102514559 12:113437672-113437694 ATGGATAGAGAGATAAAAGGTGG + Intronic
1102856132 12:116295631-116295653 ATGAATGGGTAGATGAATGATGG + Intergenic
1103064166 12:117883056-117883078 ATGGATGGATAGATGAATGGAGG - Intronic
1103178918 12:118890497-118890519 ATGAATAGATAGATGTATGAGGG + Intergenic
1103429492 12:120870785-120870807 ATTCATAGACAGTGGAATGGTGG + Intronic
1103900427 12:124300964-124300986 ATGGATAGATGGATGGATGGAGG + Intronic
1104189101 12:126460705-126460727 AAGGATGGACAGATGGATGGAGG + Intergenic
1104215769 12:126731758-126731780 TTGAGTGGACAGATGAATTGAGG - Intergenic
1104765446 12:131327366-131327388 ATGAACAGATGGATGGATGGTGG + Intergenic
1104766132 12:131331362-131331384 ATGAATGGGGGGATGAATGGTGG - Intergenic
1104766135 12:131331374-131331396 ATGGATGGATAGATGAATGGGGG - Intergenic
1104772588 12:131372866-131372888 AGGGATGGACAGATGGATGGAGG - Intergenic
1104813877 12:131634697-131634719 ATGAACAGATGGATGGATGGTGG - Intergenic
1104925730 12:132313186-132313208 ATGGATGTACAGATGTATGGAGG - Intronic
1105223301 13:18354258-18354280 ATGTATAGAGAGTAGAATGGTGG - Intergenic
1106200251 13:27530299-27530321 ATTCATAGACAGTAGAATGGTGG - Intergenic
1106233762 13:27843743-27843765 ATGAATAGAAAGATAAAATGTGG + Intergenic
1106969016 13:35113578-35113600 ATAGATAGATAGATGAGTGGAGG - Intronic
1107379360 13:39839523-39839545 ACGAATAAACTGATGAATAGAGG + Intergenic
1107445693 13:40468559-40468581 ATGGATGGAGAGATGGATGGAGG - Intergenic
1107660178 13:42631110-42631132 ATGAATAGAGAGATGAAGTTTGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108716390 13:53082346-53082368 ATGCATAGAAAGATCAATGAGGG - Intergenic
1112156887 13:96827268-96827290 ATGAACAGACAGATTGAAGGTGG + Intronic
1112445911 13:99464116-99464138 ATAGATAGATAGATGAATGGTGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113072932 13:106438927-106438949 ATGAATGGAGGGAGGAATGGAGG + Intergenic
1113400193 13:109985405-109985427 ATGAATAGAGAGAGGAAATGGGG + Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113780227 13:112972544-112972566 ATGGATAAATAGATAAATGGAGG + Intronic
1114638545 14:24203287-24203309 ATGAGAAGACAGATGAAGTGTGG - Intronic
1115027787 14:28764451-28764473 ATGGAGAGACAGAGGAATGGAGG + Intergenic
1115508997 14:34121244-34121266 ATGCATAGAAAGATGACTGGAGG - Intronic
1116599232 14:46898091-46898113 ATGAAAAGATAAATGCATGGAGG + Intronic
1116655026 14:47641552-47641574 TTGAATAGGGAGTTGAATGGTGG + Intronic
1116797662 14:49409251-49409273 ATGCTGAGACAGGTGAATGGGGG - Intergenic
1116856419 14:49956137-49956159 ATGAATAAATGAATGAATGGAGG - Intergenic
1117018885 14:51549199-51549221 ATGGATGGATAGATGGATGGAGG + Intronic
1117561852 14:56948497-56948519 ATGAATGGTCAGATGAGTGACGG + Intergenic
1119114364 14:72004922-72004944 ATTGGTAGACACATGAATGGAGG - Intronic
1119206834 14:72800690-72800712 ATGAATGGACGGATGCATGGAGG + Intronic
1119901299 14:78262260-78262282 ATGGATAGACGGATGGGTGGAGG + Intronic
1120581077 14:86249901-86249923 ATGAATATCCAGATGTTTGGAGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1121423174 14:93829995-93830017 ATGGATAGATGGATGGATGGTGG + Intergenic
1121567860 14:94924070-94924092 AATAATAGACAGAGGAATGAAGG - Intergenic
1121853590 14:97246281-97246303 ATGAACAGATAAATGAATGGTGG - Intergenic
1121985230 14:98498790-98498812 AAAAATAGAAAGATGAAAGGAGG + Intergenic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1122794207 14:104197816-104197838 ATGAATAGGTGGATGGATGGCGG - Intergenic
1124069415 15:26377801-26377823 ATTAATTGACTCATGAATGGGGG + Intergenic
1124383235 15:29185306-29185328 ATGAATTCAGAGATGCATGGAGG - Intronic
1124551724 15:30687250-30687272 ATGAATAGAGAAATAAGTGGGGG + Intronic
1124679526 15:31718415-31718437 ATGAATAGAGAAATAAATGGGGG - Intronic
1125101812 15:35922391-35922413 ATGAGCAGACAGATGAAGAGAGG - Intergenic
1125118791 15:36127838-36127860 ATCAAAAAACAGATGATTGGTGG - Intergenic
1125838315 15:42773768-42773790 ATGAATGGAAAGAGGAAAGGTGG + Intronic
1126279820 15:46932317-46932339 AAGAACAGACAGATCAGTGGAGG - Intergenic
1126337987 15:47607351-47607373 ATTTATAGACAGACAAATGGAGG + Intronic
1126843256 15:52737484-52737506 TTGAATAGATACATAAATGGGGG - Intergenic
1126921075 15:53525448-53525470 ATGAATAAATGAATGAATGGAGG - Intronic
1127687029 15:61356450-61356472 ATGAATAGACAAATAAAATGTGG + Intergenic
1128518919 15:68362553-68362575 ATGGATAGACAGATGATAGATGG + Intronic
1128734126 15:70042729-70042751 ATGGATGGATAGATGAATGGGGG - Intergenic
1128759993 15:70210074-70210096 ATAAATAGACTGATGAAGGAGGG + Intergenic
1128773750 15:70303048-70303070 ATGAATGGGTAGATGAGTGGGGG + Intergenic
1128793618 15:70449879-70449901 ATGAATGGAGAGAGGGATGGAGG + Intergenic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1129248308 15:74293396-74293418 ATGAATGGATGGATGAATGCAGG - Intronic
1129254250 15:74325144-74325166 ATGGACAGAGAAATGAATGGAGG - Intronic
1129720065 15:77873005-77873027 ATGAATGGATGGATGGATGGGGG + Intergenic
1130364879 15:83225920-83225942 AGGAATAGATAAATCAATGGAGG - Intergenic
1131475233 15:92732901-92732923 ATGAATAGATAGACAAATTGTGG + Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1131794429 15:95999856-95999878 ATGAACAGATAAATGAATGGGGG + Intergenic
1132030901 15:98437924-98437946 ATGGATAGATGGATGGATGGAGG + Exonic
1132644951 16:994465-994487 ATGAACAGATGGATGAATGAGGG - Intergenic
1133165932 16:3947193-3947215 ATGAACAGACAGGTGAATGGAGG + Intergenic
1133326811 16:4946989-4947011 ATGGATAGATGGATGGATGGAGG - Intronic
1133399427 16:5473865-5473887 ATGGAAAGACAGATGTAAGGGGG + Intergenic
1133739441 16:8640481-8640503 AAGAATGGACGGATGGATGGAGG + Intronic
1133841937 16:9417853-9417875 ATGGATAGATGGATGAATGGAGG + Intergenic
1134105942 16:11486115-11486137 ATGGGTAGACAGATGATGGGTGG + Intronic
1134105971 16:11486251-11486273 GTGAATAGATGGATGGATGGAGG + Intronic
1134105983 16:11486306-11486328 ATGGGTAGACAGATGATGGGTGG + Intronic
1134106008 16:11486455-11486477 ATGGGTAGACAGATGATGGGTGG + Intronic
1134456757 16:14400691-14400713 CTGAACGAACAGATGAATGGGGG - Intergenic
1134766924 16:16767259-16767281 ATGGATAGATGGATGGATGGTGG - Intergenic
1135187364 16:20326945-20326967 ATGAATAAATAAATCAATGGGGG + Intronic
1135517865 16:23149999-23150021 ATGAATGGAATGATGAATGATGG - Intergenic
1135792956 16:25414860-25414882 ATAAATAGATGAATGAATGGAGG + Intergenic
1135804468 16:25529724-25529746 ATGAAAAGACAAATCAATGATGG + Intergenic
1135840295 16:25870087-25870109 ATAGATGGACAGATGGATGGAGG - Intronic
1135846973 16:25927764-25927786 ATGAATGGAGAAAGGAATGGAGG - Intronic
1136279129 16:29197787-29197809 ATGGATGGGTAGATGAATGGAGG + Intergenic
1137071802 16:35910273-35910295 ATGAACAGAGAGGTGACTGGAGG + Intergenic
1137085314 16:36113692-36113714 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1137368625 16:47883601-47883623 GTGAACAGAGGGATGAATGGTGG - Intergenic
1137520650 16:49192537-49192559 AAGAATAGATAAATAAATGGTGG + Intergenic
1140878307 16:79173847-79173869 ATTAAAAGAAAGATGGATGGGGG + Intronic
1140966300 16:79969309-79969331 ATAGATAGACAGATAGATGGAGG - Intergenic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141110067 16:81265182-81265204 ATGGATAGGTGGATGAATGGTGG - Intronic
1141110236 16:81265856-81265878 ATGGATAGATGGATGAATGGTGG - Intronic
1141118290 16:81330535-81330557 ATGAATAAACTAATAAATGGAGG + Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1141421614 16:83921375-83921397 ATGGATGGATAGATGGATGGAGG + Exonic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141593965 16:85086420-85086442 ATGAAGAGTGAGATGAATGTTGG + Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141619874 16:85231476-85231498 ATGAATAGATGGATGGACGGAGG + Intergenic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1142152497 16:88518868-88518890 ATGGATAGATGGATGAGTGGAGG + Intronic
1142152592 16:88519249-88519271 ATGGATAGATGGATGAGTGGAGG + Intronic
1142152628 16:88519429-88519451 ATGGATGGATAGATGCATGGTGG + Intronic
1142152707 16:88519746-88519768 ATAGATGGACAGATGGATGGTGG + Intronic
1142152726 16:88519820-88519842 ATGGATGGACAGATAGATGGTGG + Intronic
1142463777 17:115347-115369 ATGAAAAGCCAGATGAAGAGAGG + Intergenic
1144097187 17:11910433-11910455 ATGAATAGAGAGATAAAATGTGG - Intronic
1144317951 17:14081856-14081878 ATGAAAAACTAGATGAATGGTGG + Intronic
1144386814 17:14755756-14755778 ATGAATGGGGACATGAATGGTGG - Intergenic
1145261364 17:21356679-21356701 ATGGATGGATGGATGAATGGAGG - Intergenic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146891923 17:36511814-36511836 AGGAATAGACTGGTGACTGGGGG + Intronic
1146924147 17:36732476-36732498 ATGAATGGATGGATGGATGGTGG - Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1147404002 17:40197709-40197731 ATGAATGGACAAATGCATTGGGG + Intergenic
1147851506 17:43446993-43447015 ATGAATAGATAAATGAAATGTGG - Intergenic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1151165643 17:72201269-72201291 ATGAATAGACAGATGCTAGGTGG + Intergenic
1151208010 17:72522594-72522616 ATGAATAGAGGGATGAATTTGGG + Intergenic
1151273613 17:73015902-73015924 ATGAAAAGAATGAGGAATGGCGG + Intronic
1152031137 17:77844092-77844114 ATGAATGGACAAATGAATTTTGG + Intergenic
1152038018 17:77885221-77885243 ATGAATGGATGGATGGATGGAGG + Intergenic
1152296203 17:79468378-79468400 ATGCATAGACAGATGATGGATGG + Intronic
1152311143 17:79550606-79550628 ATGAGTGGACAGATGATGGGTGG + Intergenic
1152312479 17:79559536-79559558 ATGGGTGGATAGATGAATGGTGG + Intergenic
1203182561 17_KI270729v1_random:76138-76160 ATGAAAAGACAAACGAAAGGAGG + Intergenic
1203190504 17_KI270729v1_random:181635-181657 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1153974170 18:10252382-10252404 ATGAATGGATAGACGGATGGTGG - Intergenic
1155151128 18:23123815-23123837 ATGAATAAATACATAAATGGAGG + Intergenic
1155637395 18:27972097-27972119 ATGCCTAGACAGAAGGATGGGGG - Intronic
1156040575 18:32816116-32816138 ATGAATTGGCAGATGCATTGAGG - Intergenic
1156434268 18:37109716-37109738 GTGAATAGACAGAGTACTGGTGG + Intronic
1156471614 18:37380602-37380624 ATGAATAGATGGATGAATGGTGG - Intronic
1156471675 18:37380999-37381021 ATGGATAGATGGATGGATGGTGG - Intronic
1157453463 18:47805248-47805270 TTGAATGAACAAATGAATGGAGG + Intergenic
1157877292 18:51285707-51285729 ATGAAAGGACAGGTGCATGGAGG + Intergenic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1158300769 18:56049882-56049904 AAGAATAGGGAGATGAATCGAGG + Intergenic
1159296790 18:66500690-66500712 TTAAGTAGACAGATAAATGGAGG - Intergenic
1160047294 18:75398803-75398825 ATAGATAGACAGACCAATGGTGG - Intergenic
1160049173 18:75415692-75415714 ATGAATAAGCAGATGATTGATGG - Intronic
1160094162 18:75855968-75855990 ATGGGCAGACAGATGGATGGCGG - Intergenic
1160315090 18:77836131-77836153 ATGAATAGATGGATGAATTGGGG + Intergenic
1161090418 19:2357377-2357399 ATGGATGGACAAATGGATGGTGG - Intergenic
1161105270 19:2440689-2440711 ATGAATGGATAGATGATTGAGGG - Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161287399 19:3475940-3475962 ATGAATGGACTGCTGCATGGAGG + Intronic
1161364534 19:3870581-3870603 ATGAATAAACAAATAAATGGAGG + Intergenic
1161372995 19:3924080-3924102 TTGAATAGATGGATGAGTGGAGG + Intronic
1161422858 19:4185184-4185206 ATGAGTGGATGGATGAATGGTGG + Intronic
1161449092 19:4334667-4334689 ATGGATAGATGGATGGATGGGGG - Intronic
1161632874 19:5367756-5367778 ATGAATGGATGGATGAATGAGGG + Intergenic
1161900426 19:7114691-7114713 AAAAATAAACAGGTGAATGGGGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162062917 19:8107589-8107611 ATGAATGGACAGAAAGATGGGGG + Intronic
1162062976 19:8107896-8107918 ATAAATGGACAGAAGGATGGAGG + Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1163033018 19:14556650-14556672 ATGAATGGATAAATGAATGCAGG + Intronic
1163238360 19:16043138-16043160 ATGGATGGATGGATGAATGGAGG + Intergenic
1163238393 19:16043273-16043295 ATGAATAAACGAATGGATGGAGG + Intergenic
1163238401 19:16043309-16043331 ATGGGTAGATGGATGAATGGAGG + Intergenic
1163238428 19:16043404-16043426 ATGAATAAACGAATGGATGGAGG + Intergenic
1163290843 19:16378089-16378111 ATTAATGGACGAATGAATGGCGG + Intronic
1163350721 19:16775001-16775023 ATAAATAGATGGGTGAATGGAGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163571381 19:18084271-18084293 ATGGATGGATAGATGGATGGGGG - Intronic
1164266182 19:23619967-23619989 AGTAATAAACAGATGAATGCAGG - Intronic
1164524099 19:29000834-29000856 ATGAACAGAGAATTGAATGGAGG - Intergenic
1164631871 19:29767348-29767370 ATGGATAGACAGATGACTGATGG + Intergenic
1164706487 19:30323924-30323946 AGGGATGGACAGATGGATGGAGG - Intronic
1164880638 19:31729959-31729981 ATGGATAGATAGATAAATAGAGG - Intergenic
1166982848 19:46641563-46641585 ATGAATGGACAAATGAAATGTGG + Intergenic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
1167763009 19:51461291-51461313 ATGAAAGGACACACGAATGGGGG - Intergenic
1168703398 19:58454631-58454653 ATGAATACAAAGATAAATGATGG - Intronic
1202668744 1_KI270709v1_random:28039-28061 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
925167206 2:1723700-1723722 ATGAATGGATGGATGAAAGGGGG + Intronic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
925745392 2:7039334-7039356 ATGGATAGAGAGATGTATGATGG + Intronic
925777025 2:7345806-7345828 ATGGATGGATAGATGAATGGTGG + Intergenic
925785296 2:7426369-7426391 ACGAATAGATAGATGAATGTGGG + Intergenic
926585628 2:14682568-14682590 ATAGATAGATAGATGAAAGGGGG + Intergenic
926727409 2:16009306-16009328 ATGAAGGGACAGGTGAATGCAGG - Intergenic
926986282 2:18627904-18627926 ATGGATGGATGGATGAATGGCGG - Intergenic
927197698 2:20559542-20559564 ATGGATAGGTGGATGAATGGAGG + Intergenic
927422682 2:22949467-22949489 ATGACTTGACAGATGAAGGAAGG + Intergenic
927431727 2:23031878-23031900 GTGAGTGGAAAGATGAATGGAGG - Intergenic
927855693 2:26526347-26526369 ATGAATTGATAAATGGATGGAGG + Intronic
927972655 2:27315541-27315563 ATGAATGAATGGATGAATGGAGG - Intronic
929037193 2:37705598-37705620 CTTAATAGACAGATAAATGAAGG - Intronic
929653308 2:43704202-43704224 AGGAATAGAAAGTAGAATGGCGG + Intronic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
929874317 2:45783917-45783939 ATGAAGAAAGAAATGAATGGAGG - Intronic
930020549 2:46999317-46999339 ATAGGTGGACAGATGAATGGTGG - Intronic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931593181 2:63909309-63909331 ATGAATGAATAAATGAATGGTGG + Intronic
931853890 2:66281524-66281546 ATGAATGGACAGAGAGATGGAGG - Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932095750 2:68846915-68846937 GTGGATAGACTGATGGATGGTGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933596384 2:84287657-84287679 ATGAATGAATAAATGAATGGAGG + Intergenic
933863478 2:86494397-86494419 ATTAATAGAATGAAGAATGGAGG - Intergenic
934180637 2:89616457-89616479 ATGTATAGAGAGTAGAATGGTGG + Intergenic
934290937 2:91690716-91690738 ATGTATAGAGAGTAGAATGGTGG + Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935030154 2:99313812-99313834 ATGAATAAACAGAGAAATGTAGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935384825 2:102488922-102488944 ATGAATGGATGGATGGATGGAGG - Intronic
936238198 2:110764277-110764299 TTGAATGGATAGATAAATGGTGG + Intronic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936523065 2:113224242-113224264 ATGAATTAAAAGATGGATGGAGG + Intronic
936615952 2:114047991-114048013 ATGGATGGACGGATGGATGGAGG - Intergenic
936682599 2:114791363-114791385 ATTAATAAACAAATGAATGCTGG + Intronic
936692260 2:114904484-114904506 AAGAAGAGAGAGATGAATTGAGG + Intronic
937065820 2:119016803-119016825 ATGAATAGATAGATGGATACAGG + Intergenic
937503987 2:122515640-122515662 AACAATAGACAGATTAATAGGGG + Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
939015060 2:136892910-136892932 ATGAAGAGGCAGATAAATGTAGG - Intronic
939117498 2:138077173-138077195 TTGAATATACAGATGCATGGGGG + Intergenic
939469091 2:142596772-142596794 TTGAATAGACAAATAAATGCTGG - Intergenic
939939979 2:148337586-148337608 ATGAAGAGACAGATGGCTGAGGG + Intronic
940001883 2:148974854-148974876 ATGAATAGACGCCTGCATGGCGG + Intronic
940478835 2:154202403-154202425 ATTAGTAGAAACATGAATGGAGG + Intronic
940961875 2:159795616-159795638 ATGAACAGAGATCTGAATGGTGG + Intronic
941071287 2:160957247-160957269 TTGAATAGACTGATGGATTGGGG - Intergenic
941388880 2:164887022-164887044 ATGCATAGAAAAATGACTGGAGG + Intergenic
942356678 2:175121851-175121873 ATGATAAGACAAATTAATGGTGG - Intronic
942980226 2:182071690-182071712 ATGAACAGATAAATCAATGGAGG - Intronic
943639499 2:190343456-190343478 ATGAGAGTACAGATGAATGGAGG + Exonic
943802499 2:192079304-192079326 ATGAAAAGAAAGAGGAAAGGAGG - Intronic
944332688 2:198490170-198490192 AGGAATTGAATGATGAATGGTGG - Intronic
944592021 2:201227010-201227032 ACAAATATACAGATGCATGGGGG + Intronic
944649177 2:201811622-201811644 ATGAATAAAATGATGAATGAGGG + Intronic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
945912841 2:215669179-215669201 AAGAACAGGCAGATGAATGGAGG - Intergenic
946169162 2:217884211-217884233 ATGGATGGACAGATTAATGAAGG + Intronic
946366733 2:219253385-219253407 ATGCATACACAGAGGAAAGGGGG + Intronic
946472046 2:219969839-219969861 GTGAACAGACAGTTGAATTGTGG + Intergenic
947122666 2:226834356-226834378 ATGAAAAGTCAAATGAATGCGGG - Intergenic
947258153 2:228189320-228189342 ATGAATAGACCAAGGAAAGGAGG - Intergenic
947698058 2:232209449-232209471 AGGAAAAGACAGAGAAATGGTGG + Intronic
948170264 2:235895735-235895757 ATGGATGGATGGATGAATGGAGG + Intronic
948193112 2:236075410-236075432 AACATAAGACAGATGAATGGGGG + Intronic
948375583 2:237518327-237518349 ATGAATAGATTGATAAATAGGGG + Intronic
948606094 2:239136415-239136437 ATGAATAGACAGAGAAAATGTGG - Intronic
1169773338 20:9225082-9225104 ATGGATAGACCGATGAATGAAGG + Intronic
1169849724 20:10035763-10035785 ATCATTAGAAAGAGGAATGGAGG - Intronic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170195752 20:13687583-13687605 ATGAATGGATAAATGAATTGTGG - Intergenic
1170687511 20:18582656-18582678 AGAAACAGAAAGATGAATGGTGG - Intronic
1170814753 20:19704195-19704217 ATGGATGGATAGATGGATGGAGG + Intronic
1171063928 20:21994712-21994734 GTGGATAGAAAGCTGAATGGAGG + Intergenic
1171539875 20:25940729-25940751 ATAAATCAACAGCTGAATGGTGG + Intergenic
1171842790 20:30235947-30235969 ATAAATCAACAGCTGAATGGTGG + Intergenic
1172131200 20:32656947-32656969 ATGAATGGATAAATGAAAGGTGG + Intergenic
1172202643 20:33137670-33137692 ATGAAAAGTCAGATACATGGTGG - Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1172603025 20:36196533-36196555 AGGAACAGACAGATGTCTGGAGG + Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173087697 20:39940065-39940087 ATGGATGGATAGATGGATGGAGG + Intergenic
1173465055 20:43274147-43274169 ATGGATGGAAAGATGAGTGGGGG + Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174291432 20:49511820-49511842 ATGGAAAGATGGATGAATGGAGG + Intronic
1174713760 20:52734916-52734938 ATGAATGGATAAATGAATTGTGG - Intergenic
1174747068 20:53073433-53073455 ATGAATGGATGGATGGATGGAGG - Intronic
1174748409 20:53087162-53087184 ATGAATGGAGAGAAGAATTGAGG + Intronic
1175124115 20:56738972-56738994 ATGAACGGCCAAATGAATGGAGG + Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175779243 20:61671858-61671880 ATGAATGGATGGATGGATGGTGG + Intronic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1175817281 20:61889855-61889877 ATGGATGGATAGATGGATGGTGG + Intronic
1176051619 20:63122722-63122744 ATGAATAAACGTGTGAATGGTGG + Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176731852 21:10506693-10506715 ATGTATAGAGAGTAGAATGGTGG - Intergenic
1177600208 21:23301463-23301485 ATGGCAAGACAGTTGAATGGGGG - Intergenic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179474379 21:41633963-41633985 ATGGATAGAGGGATGGATGGAGG - Intergenic
1179567379 21:42257871-42257893 ATGAGTGGAGGGATGAATGGAGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180212733 21:46304826-46304848 ATCAGTAGATAGATAAATGGAGG + Intronic
1181536744 22:23550218-23550240 ATGAATGGAAAGATGGATGGAGG - Intergenic
1181551405 22:23640962-23640984 ATGAATGGACAGATGATAGATGG - Intergenic
1181565773 22:23736397-23736419 ATGCTTTGACAGATGAATTGAGG + Intergenic
1181796852 22:25317684-25317706 ATGAATGGACAGATGATAGATGG + Intergenic
1182939894 22:34265704-34265726 ATGAAGAGAAAAATTAATGGGGG + Intergenic
1183106509 22:35618870-35618892 ATGGATGGATAGATGGATGGAGG - Intronic
1183106541 22:35618998-35619020 ATGGATGGATAGATGGATGGAGG - Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183543801 22:38444831-38444853 ATGAATGGATGGATGGATGGGGG - Intronic
1184293047 22:43508506-43508528 ATGGATGGATAGATGGATGGGGG - Intergenic
1184293186 22:43508968-43508990 ATGGATAGATGGATGGATGGGGG - Intergenic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184444686 22:44540214-44540236 ATGGATAGATGGATGAATGGTGG + Intergenic
1184731145 22:46371829-46371851 ATGAATAGGTGGATGGATGGAGG - Intronic
1184744654 22:46449279-46449301 GTGGATAGATGGATGAATGGTGG - Intronic
1184855207 22:47142773-47142795 GTGGATAGAAGGATGAATGGGGG - Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
1185196878 22:49477159-49477181 ATGGATGGATGGATGAATGGTGG + Intronic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
949096904 3:97043-97065 ATGAATAAGCAAATGAATGCAGG - Intergenic
949605560 3:5649429-5649451 ATAAATAGACAAATGATTTGTGG + Intergenic
950102838 3:10368684-10368706 GTGGATGGACAGATGGATGGCGG - Intronic
951407084 3:22314497-22314519 ATGAATAGACAAATAAACTGTGG - Intronic
952069505 3:29617057-29617079 ATGGATAGATGGATGAAAGGAGG + Intronic
952316098 3:32233605-32233627 ATTAATAGCAAGATGAAGGGAGG + Intergenic
953725512 3:45394496-45394518 CTGAAAAGACAGCTAAATGGTGG + Exonic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
955209984 3:56931796-56931818 ATTAATAGGTAGCTGAATGGTGG - Intronic
955706823 3:61736461-61736483 CTGCTTAGACAGATCAATGGGGG - Intronic
956189418 3:66594698-66594720 ATGGATAGAAAGATGACTGATGG + Intergenic
956346913 3:68289719-68289741 ATGAATAGAATGAGGAATGAGGG + Intronic
956485721 3:69720305-69720327 ATCAACAGACATATGAATGTAGG + Intergenic
957738917 3:84237524-84237546 AAGAATAGACAGATTAAGGCGGG + Intergenic
958624750 3:96609749-96609771 ATGAAATGACCTATGAATGGAGG - Intergenic
959432922 3:106277154-106277176 ATGAATAGACAAACAAATTGTGG - Intergenic
960125800 3:113997161-113997183 ATAAGTAAACAGATGAATTGTGG + Intronic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
960510022 3:118538690-118538712 ATGAATAGATAAATAAATTGTGG - Intergenic
960706385 3:120486159-120486181 ATGAATGGACACAGAAATGGTGG - Intergenic
960907660 3:122617683-122617705 ATTAATAGACATATGAGGGGAGG - Intronic
961503391 3:127353706-127353728 ATGAACAGATACATCAATGGGGG + Intergenic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
963063820 3:141246601-141246623 ATGAAGAGATTAATGAATGGAGG - Intronic
964054188 3:152432619-152432641 AAGAATGGATAGATGGATGGAGG + Intronic
964580347 3:158227424-158227446 AGGAAAAGAGAGATGAAGGGAGG - Intronic
966025826 3:175280093-175280115 AGAAATAAACAGATGAATGTGGG - Intronic
966833863 3:184034214-184034236 ATGAATGGACAGATTAAATGTGG + Intronic
966916902 3:184589640-184589662 ATGAATGGAAGGATGAATAGAGG + Intronic
967430246 3:189375668-189375690 ATGAATAGACAGAGCAAAGAGGG - Intergenic
967710521 3:192702046-192702068 AGAAATAGACAGTAGAATGGTGG - Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
968931242 4:3580585-3580607 ATGGATGGATAGATGATTGGAGG - Intronic
969155548 4:5206575-5206597 ATGGATAGGCCGATGAATGGAGG + Intronic
969277416 4:6146037-6146059 ATGAATAGACAAATAAACTGTGG + Intronic
969424817 4:7118045-7118067 AGGAATGGATAGATGGATGGTGG + Intergenic
969424907 4:7118476-7118498 AGGAATGGAAAGATGGATGGAGG + Intergenic
969424945 4:7118660-7118682 AGGAATGGAAAGATGAATGGTGG + Intergenic
969424978 4:7118808-7118830 AGGAATGGACTGAGGAATGGTGG + Intergenic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
969599351 4:8166817-8166839 GTGGATGGACAGATGGATGGAGG - Intergenic
969612324 4:8234327-8234349 ATGGACAGACAGACGAATGGAGG - Intronic
969921242 4:10541821-10541843 ATGATTAAATAGATGAATGAAGG + Intronic
969974645 4:11086007-11086029 CTGACCAAACAGATGAATGGAGG - Intergenic
969986237 4:11213918-11213940 ATGAATAATTAAATGAATGGAGG - Intergenic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
970894921 4:21091165-21091187 ATGAAGAGACACATGAATTCAGG - Intronic
972368135 4:38394960-38394982 ATGGATAGATGGATGGATGGAGG + Intergenic
972615808 4:40696934-40696956 ATGAATAGCCAGAGCACTGGGGG + Intergenic
972830714 4:42810707-42810729 ATGAGCAGATAGGTGAATGGTGG + Intergenic
973315946 4:48760134-48760156 AGAAATAGACTGATGAAGGGTGG - Intronic
974085039 4:57251208-57251230 AATATTAGACAGATGAATAGTGG + Intergenic
974277358 4:59740297-59740319 ATAAATTGACAGATGATTGATGG - Intergenic
975216759 4:71764397-71764419 ATGAATATACTGATTAATAGTGG - Intronic
976545833 4:86334656-86334678 AGGAATAGTCAGATGAAGTGGGG - Intronic
976892673 4:90069069-90069091 ATGAATAAACAAATGACAGGTGG - Intergenic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
978010639 4:103678564-103678586 ATGAATGAATAAATGAATGGAGG - Intronic
978055487 4:104259019-104259041 ATGAATAGACACATAAACTGTGG + Intergenic
978181726 4:105805802-105805824 AAGAAGAGGCAGAAGAATGGAGG - Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
979155217 4:117378435-117378457 ATGAATACATAAATAAATGGGGG + Intergenic
979928140 4:126593775-126593797 ATGAATGGATAAATAAATGGTGG + Intergenic
980647081 4:135655598-135655620 ATGAGTAGAAAGATTAAAGGCGG + Intergenic
980769451 4:137352036-137352058 ATGAATTGACAGAAGAAGGTGGG + Intergenic
981028519 4:140100261-140100283 AGGCATAGACACATGAGTGGAGG - Intronic
981143403 4:141297319-141297341 ATGAATGGATGGATGAATGGAGG + Intergenic
983630695 4:169846333-169846355 ATAAATACAAAGATGAATGAGGG - Intergenic
983770244 4:171540016-171540038 ATCAATAGATAGATGGATGATGG - Intergenic
984035510 4:174662942-174662964 GTGAATGGACAGATAAATGAAGG + Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984154071 4:176172806-176172828 ATGAAGAGAGAGAGGAAGGGAGG + Intronic
985662963 5:1166447-1166469 ATGGATGGATGGATGAATGGTGG - Intergenic
985703779 5:1389056-1389078 ATGGATGGACAGAAGAAGGGAGG - Intergenic
985813384 5:2107880-2107902 ATGAATAGATAGATATATAGAGG + Intergenic
985837191 5:2280239-2280261 ATGAATGGACAGATGGGTGGTGG + Intergenic
986389239 5:7268321-7268343 ATGACTAGACAGAAGATAGGAGG - Intergenic
987199606 5:15562693-15562715 ATGAATGGAGAGAGGAAGGGAGG - Intronic
987451914 5:18095590-18095612 ATGAATAAAAAGATGAATACAGG + Intergenic
987596384 5:20004802-20004824 ATGAATATAAAGAGGAATAGTGG + Intronic
988156080 5:27450588-27450610 ATGAATGGACAAATAAATTGAGG + Intergenic
988268801 5:28987318-28987340 ATAGATAGATAGATGAATGAGGG + Intergenic
988369864 5:30354633-30354655 ATGAATAGACTTAAGAATGTAGG + Intergenic
988932634 5:36051695-36051717 ATGGAGAGACAGATGACAGGGGG - Intronic
989295783 5:39824515-39824537 ATGAATAGACATATGACTAGCGG - Intergenic
989321493 5:40139934-40139956 ATGAATGTACAGATGAGTAGAGG + Intergenic
989428632 5:41326167-41326189 ATGCATGGATGGATGAATGGAGG - Intronic
989843958 5:46116085-46116107 GTGAATGGACAAATAAATGGTGG - Intergenic
990317849 5:54601033-54601055 ATGAATGGATAGATGATTGATGG - Intergenic
990335487 5:54768304-54768326 ATGAATATAAAGGTGACTGGGGG - Intergenic
991296610 5:65088354-65088376 ATAAATAGACAGATGAGTTCAGG + Intergenic
992923177 5:81549255-81549277 ATGAAGAGAAAGATGAAGGCAGG - Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG + Intronic
993600174 5:89912742-89912764 ATCAATAGAGAGAGGAAAGGAGG + Intergenic
994475151 5:100258537-100258559 AAGAATGGAGAGAAGAATGGAGG - Intergenic
996159283 5:120143124-120143146 ATGAATAAACAAATAAATTGTGG + Intergenic
996319473 5:122198340-122198362 AGGAAGAGACAAATTAATGGAGG + Intergenic
996509008 5:124298328-124298350 ATAGATTGACAGATGCATGGGGG + Intergenic
996657792 5:125962196-125962218 ATATATAGACAGATAAATGTAGG + Intergenic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998629744 5:143884820-143884842 GTGAATATACAGGTGAATGTAGG - Intergenic
998798493 5:145843776-145843798 ATGAATAAACTGAAGCATGGAGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
1000161011 5:158597809-158597831 AAGAACAGAGAGAAGAATGGTGG + Intergenic
1000218111 5:159184098-159184120 AAGAAAAGACAGAAGAATTGAGG + Intronic
1000325299 5:160167571-160167593 TTGAATTGACAGATGAATGAAGG - Intergenic
1000356287 5:160399497-160399519 ATCAATAGCCAGGAGAATGGGGG + Intronic
1000436112 5:161211197-161211219 ATGAATTGACAGACAAATTGAGG + Intergenic
1000607390 5:163339291-163339313 ATGACTAGACAGAAGATAGGAGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1000941127 5:167361033-167361055 TTGAAAAGACATACGAATGGGGG + Intronic
1000975313 5:167758005-167758027 ATGTATTGACAGATGCATGAAGG - Intronic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002259076 5:177981880-177981902 ATGAATGGATGGATGGATGGTGG + Intergenic
1003330623 6:5125418-5125440 AGGAACTGACAGGTGAATGGGGG - Intronic
1003972550 6:11313138-11313160 ATGAATAGATGGATGGTTGGTGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004226894 6:13793564-13793586 ATCCATAGACAGTAGAATGGAGG + Intronic
1004251679 6:14028006-14028028 ATGGAAAGAAAGAAGAATGGAGG - Intergenic
1004617374 6:17303490-17303512 AGGAAAAGACAGAGGAAGGGGGG + Intergenic
1005022254 6:21429635-21429657 ATGAAAATACAGGTGGATGGGGG - Intergenic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1006370225 6:33639734-33639756 ATGAATAGATGGATGATTGGGGG + Intronic
1006433134 6:34010466-34010488 TTGAATGGAGAAATGAATGGTGG + Intergenic
1007348720 6:41252586-41252608 ATAAATAGATGGATGAGTGGAGG - Intergenic
1008380353 6:50834147-50834169 CTTAATAGACAGGTGATTGGTGG - Intronic
1009489689 6:64274168-64274190 ATGAATGAATAAATGAATGGAGG - Intronic
1009911625 6:69937139-69937161 ATGAATAGAAAAGTGAAGGGAGG + Intronic
1009976027 6:70671846-70671868 ATCAATAGACGGATAAATTGTGG - Intronic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1010639153 6:78301625-78301647 ATGAATAGGCACATGAAAGGTGG - Intergenic
1012010826 6:93782722-93782744 ATAAATAAATAGATAAATGGAGG + Intergenic
1012366802 6:98450986-98451008 ATGCCAAGACAGTTGAATGGGGG - Intergenic
1013003404 6:106047426-106047448 ATGGACAGACACATGAATTGTGG + Intergenic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013377562 6:109532629-109532651 ATGAATAGAAAAATAAAAGGTGG - Intronic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1014314954 6:119852174-119852196 ATGAATGGGCAAATGAATTGGGG - Intergenic
1014863578 6:126500653-126500675 ATATATAGAAATATGAATGGAGG - Intergenic
1014869056 6:126568851-126568873 ATAAGTAGACAGTAGAATGGAGG + Intergenic
1014976927 6:127898750-127898772 ATGAATAGACAAATAAAATGTGG + Intronic
1015820212 6:137252827-137252849 ATGAAGGGAGAGAGGAATGGAGG - Intergenic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016317747 6:142808682-142808704 ATGAATAGAAGGATGGATGGAGG + Intronic
1016929774 6:149392638-149392660 ATGAAATGACAGCTGAATGAAGG - Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1018965493 6:168484708-168484730 ATGAATAGATAAATGAAATGTGG + Intronic
1018970696 6:168526626-168526648 ATAAATAGACACATAAATGAAGG + Intronic
1019145425 6:169972633-169972655 AAGAAAAGAAAGATGAATGCGGG + Intergenic
1019326834 7:442639-442661 ATGAATGGATGGATGGATGGAGG + Intergenic
1019326889 7:442901-442923 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326903 7:442969-442991 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326922 7:443064-443086 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326973 7:443292-443314 ATGGATAGATGGATGGATGGTGG + Intergenic
1019327033 7:443570-443592 ATGAATGGATGGATGAATGGTGG + Intergenic
1019345529 7:528229-528251 ATGAATAGATAGATGATTGATGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019894758 7:3975146-3975168 ATGAATAGAGAGGGGAGTGGAGG - Intronic
1019980255 7:4616160-4616182 ATGGATAGACAAATAAGTGGTGG + Intergenic
1020471174 7:8536882-8536904 ATGAGTATCCAGATAAATGGTGG + Intronic
1021668360 7:23011287-23011309 AGGATTAGAGAGATGATTGGGGG - Intronic
1022219088 7:28294493-28294515 ATGAATGCATGGATGAATGGAGG + Intergenic
1023112824 7:36831308-36831330 AAGTATAGAAAGAAGAATGGAGG - Intergenic
1023636822 7:42220379-42220401 ATGGATGGACAGAAGGATGGAGG + Intronic
1025291253 7:57726651-57726673 ATAAATCAACAGCTGAATGGTGG + Intergenic
1025319253 7:58075586-58075608 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025477672 7:60946055-60946077 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025554449 7:62287605-62287627 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1025560332 7:62365669-62365691 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1026080139 7:67210663-67210685 ATGGATAGACAGATGACGGATGG - Intronic
1026196396 7:68177280-68177302 ATGAAGGGACAGATGACTGAAGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026384824 7:69836023-69836045 CTGAAGAAACAGATAAATGGTGG - Intronic
1026679405 7:72454168-72454190 ATGAATTGAGAGCTGAATTGAGG - Intergenic
1026903309 7:74048792-74048814 ATGGATAGATGGATGCATGGAGG - Intronic
1026903332 7:74048924-74048946 ATGGATAGATGGATGCATGGAGG - Intronic
1026903510 7:74049813-74049835 ATGGATAGATGGATGCATGGAGG - Intronic
1026903609 7:74050314-74050336 ATGGATAGATGGATGCATGGAGG - Intronic
1027163805 7:75820848-75820870 ATGGATAGATAGATGGGTGGAGG - Intronic
1027580354 7:79986499-79986521 ATGAATAGACATAACAATGACGG + Intergenic
1029045767 7:97626503-97626525 ATGAATGGATGGATGGATGGAGG + Intergenic
1030158264 7:106479747-106479769 ATGCATATACAGATGTATGTTGG + Intergenic
1030972006 7:116069794-116069816 ATCAGTAGAAAGATGAATTGTGG - Intronic
1031359522 7:120831605-120831627 AGGAATAGAGAGTAGAATGGTGG + Intronic
1031922587 7:127612747-127612769 ATAAATGGATGGATGAATGGAGG + Intronic
1033445736 7:141420338-141420360 ATGAATAAATAAATGAATGTAGG + Intronic
1033916970 7:146338095-146338117 ATGGATATACAGATATATGGGGG + Intronic
1034094751 7:148396864-148396886 ATAAATAGCCATATGAATGTGGG + Intronic
1034270412 7:149800934-149800956 ATGGGTAGATAGATGCATGGTGG - Intergenic
1034883616 7:154780886-154780908 ATGAATAGATAAATGCATGATGG + Intronic
1035692359 8:1568548-1568570 CTGAGTAGACAGTGGAATGGGGG - Intronic
1035896357 8:3407075-3407097 ATGGAAAGAAAGATGAATGGAGG + Intronic
1036054993 8:5241855-5241877 ATGAATAGACAGATACATAATGG + Intergenic
1036111413 8:5907147-5907169 AGGAATAGAGAGATGGAGGGAGG - Intergenic
1036143803 8:6233720-6233742 ATGAAGAGACAATAGAATGGTGG - Intergenic
1037807078 8:22064162-22064184 ATGGATGGATAGATGAATGCAGG + Intronic
1038036859 8:23693543-23693565 GTGAATAGACAGCTGACTAGGGG + Intergenic
1038325079 8:26566971-26566993 ATGGATAGACAGATGACGGGTGG - Intronic
1038461461 8:27720777-27720799 ATGAATGGATGGATGAATAGAGG - Intergenic
1039085201 8:33772978-33773000 ATAAGGAGACAGATGAATTGAGG - Intergenic
1039411130 8:37356142-37356164 ATGAATAGATGGATGCATGTAGG + Intergenic
1039909352 8:41811937-41811959 TTAAATATTCAGATGAATGGAGG - Intronic
1040374452 8:46810437-46810459 CGGGATAGACAGGTGAATGGCGG - Intergenic
1040466269 8:47698181-47698203 TTGAAAAGACAGACTAATGGTGG + Intronic
1040605233 8:48924775-48924797 ATGAATATGCATATGAATTGAGG - Intergenic
1040673961 8:49726326-49726348 ATGAATAAAAAAATAAATGGAGG + Intergenic
1041157705 8:55005242-55005264 ATGAATTGAGACTTGAATGGCGG + Intergenic
1041345265 8:56890441-56890463 TTGAATAAACAAATGAGTGGGGG + Intergenic
1041636063 8:60146357-60146379 ATGAAGGGAGAGATTAATGGAGG + Intergenic
1042018620 8:64345189-64345211 TGGACTAGACAGATGACTGGAGG - Intergenic
1043072293 8:75653752-75653774 ATGAGGAGATGGATGAATGGAGG + Intergenic
1043932961 8:86111460-86111482 ATGAATGGACAAAGGAAAGGTGG - Intronic
1044009480 8:86975412-86975434 ATAAGTAGACAGTAGAATGGTGG - Intronic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044365607 8:91341907-91341929 ATAAATAAACAAATAAATGGAGG - Intronic
1044605873 8:94046840-94046862 ATGAATAGGCAGAGGTCTGGAGG - Intergenic
1044647901 8:94464034-94464056 ATGAATAGATATATAAATTGTGG + Intronic
1045113878 8:98961059-98961081 GTGAAGAAAGAGATGAATGGGGG + Intergenic
1046026832 8:108734403-108734425 ATAGATAGACTGATGAAAGGGGG - Intronic
1046315623 8:112497656-112497678 ATGAATGGACATATAAATTGAGG - Intronic
1046935944 8:119885835-119885857 ATTAATTGACAGATGGATAGAGG - Intronic
1047006577 8:120626275-120626297 ATGAATAGATAGATACAGGGAGG + Intronic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047228846 8:122978991-122979013 ATGAATAGACGGATGATGGATGG + Intergenic
1047306844 8:123659401-123659423 ATGGATGGATAGATGGATGGAGG - Intergenic
1047306922 8:123659867-123659889 ATGAATGGATAAATGAATGCTGG - Intergenic
1047513299 8:125531813-125531835 ATGAACAGCCAGATGAAGAGGGG + Intergenic
1048165588 8:132058986-132059008 ATGAGGAGATAAATGAATGGAGG - Intronic
1048979825 8:139697266-139697288 ATGGATAGGTAGATGAGTGGTGG + Intronic
1049042186 8:140120858-140120880 ATGAATGGATGGATGAATGTTGG - Intronic
1049223498 8:141438649-141438671 TTGAATGGAGGGATGAATGGAGG + Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350778 8:142163432-142163454 ATGGATTGACGGATGGATGGAGG + Intergenic
1049350808 8:142163603-142163625 ATGAATTGATAGATGGATGGAGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350892 8:142164045-142164067 ATGGATTGACGGATGGATGGAGG + Intergenic
1049350969 8:142164457-142164479 ATGAATTGACGGATGGATGGAGG + Intergenic
1049364317 8:142229364-142229386 ATGGATAGATGGATGGATGGTGG + Intronic
1049405168 8:142449163-142449185 ACGGACACACAGATGAATGGAGG - Intergenic
1049428466 8:142548363-142548385 ATGAATGGATGGATGAATGGGGG + Intergenic
1049474937 8:142792782-142792804 ATGAATGGATCGCTGAATGGAGG - Intergenic
1050078161 9:1886936-1886958 TTGAATACGTAGATGAATGGAGG - Intergenic
1050213136 9:3287631-3287653 ATGAATGGATGGATGAATGATGG - Intronic
1050779061 9:9307411-9307433 AGGAAAAGACATAGGAATGGAGG - Intronic
1050984286 9:12062318-12062340 ATGGGTAGACAGATGAAGAGAGG - Intergenic
1051138681 9:13953568-13953590 ATGAATAGAAAGTGGACTGGAGG + Intergenic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051407687 9:16756393-16756415 AGTAATAGAGAGAGGAATGGAGG - Intronic
1051496786 9:17732303-17732325 AGGAAAAGACAAATGCATGGTGG + Intronic
1051648600 9:19296256-19296278 ATGATTAGAAAGATGGCTGGTGG + Intronic
1052067314 9:24038101-24038123 ATGAAAAGACACATGAAGAGTGG - Intergenic
1052617531 9:30860831-30860853 ATGGATGGATAGATGGATGGAGG + Intergenic
1052751902 9:32500291-32500313 TTGAATATACAGATCAATGTAGG + Intronic
1053167736 9:35856453-35856475 ATGATTAGATAGATAAGTGGAGG + Intergenic
1053276681 9:36788458-36788480 ATGGATAGACAGATGTGTGAAGG + Intergenic
1053802980 9:41775748-41775770 ATGAATGGATGGATGGATGGTGG - Intergenic
1054142279 9:61539358-61539380 ATGAATGGATGGATGGATGGTGG + Intergenic
1054165192 9:61718720-61718742 ATAAATCAACAGCTGAATGGTGG - Intergenic
1054191271 9:61987058-61987080 ATGAATAGATGGATGGATGGTGG - Intergenic
1054462028 9:65470509-65470531 ATGAATGGATGGATGGATGGTGG + Intergenic
1054647097 9:67600659-67600681 ATGAATAGATGGATGGATGGTGG + Intergenic
1056000512 9:82211372-82211394 TTGAATCTACAGATGAATGTAGG - Intergenic
1056897880 9:90567691-90567713 GTGAGTATACTGATGAATGGAGG - Intergenic
1056995970 9:91459856-91459878 ATGGATGGATGGATGAATGGGGG + Intergenic
1057019542 9:91685801-91685823 ATAGATAGACAGATGAGAGGGGG - Intronic
1057336347 9:94158555-94158577 ACGAACAGACAGATGAACTGAGG + Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1057842578 9:98497996-98498018 ATGAATGGATAAATGAATTGTGG + Intronic
1058677834 9:107415707-107415729 TTGAATAAATAAATGAATGGGGG - Intergenic
1059205960 9:112465778-112465800 ATGAATAGGTAAATGAATTGTGG - Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059333740 9:113555139-113555161 AGGAATAGACAGATCAAAGAGGG - Intronic
1059670477 9:116486400-116486422 ATGAAGAGACGAATGGATGGAGG + Intronic
1060037190 9:120265549-120265571 ATGAACAGATGGATGAATGGAGG + Intergenic
1060193469 9:121607794-121607816 ATAAATAAGCAGATGAATGAGGG + Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1060720863 9:125976387-125976409 TTGAATAAATAGATGAAGGGAGG + Intergenic
1060816951 9:126640077-126640099 ATGTATAGAAAGAAGAAGGGAGG + Intronic
1061245079 9:129397441-129397463 ATAAATGGAAAGATGGATGGAGG + Intergenic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061950508 9:133933418-133933440 ATGAATGGGTGGATGAATGGTGG + Intronic
1061963389 9:133999214-133999236 ATGAATACAGGGATGAATGGAGG - Intergenic
1061964093 9:134003483-134003505 ATACATGTACAGATGAATGGTGG - Intergenic
1061981049 9:134103827-134103849 CTGGATGGATAGATGAATGGTGG - Intergenic
1062092529 9:134685899-134685921 ATGAATGGATGGATGGATGGTGG - Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062112300 9:134788765-134788787 ATGAGTAGACAGGTGGATGGTGG + Intronic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1062201331 9:135304386-135304408 ATGAGTGGATAGATGAATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185498559 X:579075-579097 ATGAATAGAGAGATAGATGATGG + Intergenic
1185498672 X:580572-580594 ATGGATAGATAGATGATTGATGG + Intergenic
1185498680 X:580707-580729 ATGGATAGATAGATGATTGATGG + Intergenic
1185498716 X:581272-581294 ATGGATAGATAGATGATTGATGG + Intergenic
1185530093 X:810877-810899 ATGAATAGACAGATAACAGATGG + Intergenic
1185543724 X:925204-925226 ATGAATAGATGGAAGGATGGTGG + Intergenic
1185632753 X:1527364-1527386 ATGAATGGGCAAATGAATAGTGG - Intronic
1185660416 X:1723784-1723806 ATGAATAGATAGATGATAGATGG + Intergenic
1185660425 X:1723929-1723951 ATGAATAGATAGATGATAGATGG + Intergenic
1185694404 X:2184512-2184534 ATGGATAGACATATGACAGGTGG - Intergenic
1185695786 X:2193432-2193454 ATGGATAGACAGATACATGATGG - Intergenic
1186002030 X:5023561-5023583 ATGAATGGATGGATGGATGGTGG - Intergenic
1186094855 X:6089484-6089506 ATTAAGAGACAGAGGAATTGTGG + Intronic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186742260 X:12530843-12530865 ATGGATGAATAGATGAATGGTGG + Intronic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188080528 X:25833984-25834006 AAGAATAGATAAATAAATGGGGG + Intergenic
1188206404 X:27364313-27364335 ATGCATAGAGACATGAATAGAGG - Intergenic
1188553057 X:31382361-31382383 ATGACTAGACAGAAGATAGGAGG - Intronic
1189032545 X:37465145-37465167 ATGAATACATAGCTCAATGGGGG - Intronic
1189065546 X:37804585-37804607 ATGAATAGATAAATGAAAAGTGG + Intronic
1189212157 X:39292566-39292588 ATGAATAGCTAGGTGGATGGTGG - Intergenic
1189556609 X:42151887-42151909 ATGGACAGATAGAAGAATGGAGG - Intergenic
1190097482 X:47493278-47493300 ATGCATAGAGTGAGGAATGGGGG + Intergenic
1190373120 X:49762264-49762286 AAGAAGAGAAAGAGGAATGGAGG - Intergenic
1190396912 X:49994314-49994336 GTGATTAGACAGATGTATGGTGG + Intronic
1192483510 X:71505190-71505212 ATAAATAGATAAATAAATGGGGG + Intronic
1193318499 X:80092914-80092936 ATGAATAGATAAATGAAATGGGG - Intergenic
1193748727 X:85316698-85316720 ATGAATAGACAAATCAATCTTGG - Intronic
1195006877 X:100693802-100693824 ATGATTAGACAAATGAAATGTGG + Intronic
1195048731 X:101078259-101078281 GTGAGTAGATAGATGAGTGGTGG + Intergenic
1195646221 X:107233512-107233534 AGAAATAGAGAGAAGAATGGTGG - Intronic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1196531640 X:116794167-116794189 ATGAATGGAAAAATGAATTGTGG - Intergenic
1196553154 X:117054630-117054652 ATGAATAGAAAGGTAAATGTAGG - Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1197320235 X:125020046-125020068 ATGATGAGAAAGATGAATGTTGG - Intergenic
1197421904 X:126247329-126247351 AAGAATAGACAGATTAGTTGTGG - Intergenic
1198513418 X:137377899-137377921 CTGGATGGACAAATGAATGGAGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1200085482 X:153602296-153602318 TTGAATAGAAAGATGAAGGGTGG - Intergenic
1200365984 X:155664506-155664528 ATAAATAGACAAATAAATGGTGG + Intronic
1200757350 Y:7002351-7002373 AGGAAGAGACAGATGAACTGAGG + Intronic
1200766966 Y:7088300-7088322 ATGAAAATGCAGATGAATGGGGG - Intronic
1201691563 Y:16771847-16771869 ATGAGTAGATAGATGATAGGTGG - Intergenic
1201917333 Y:19196255-19196277 ATGGATAGATAAATGAATGATGG + Intergenic