ID: 918469525

View in Genome Browser
Species Human (GRCh38)
Location 1:184857144-184857166
Sequence CTTCCAACAGATAGAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918469525 Original CRISPR CTTCCAACAGATAGAGTGCA AGG Intronic
904197771 1:28798600-28798622 CTTCCACCAGATTGACAGCAAGG + Intergenic
905474866 1:38218934-38218956 CTTCGGACAGATAGAATACAAGG + Intergenic
906920068 1:50054824-50054846 CTTCCAGAAGCAAGAGTGCAAGG - Intronic
907607667 1:55834680-55834702 CTTCCAATTGAGAGAGTCCATGG + Intergenic
907612669 1:55888304-55888326 CTTCCAAAAGACAAAGTGCCGGG - Intergenic
907911458 1:58830789-58830811 CTTCCAACAGATAAAAGGGAGGG - Intergenic
908917542 1:69147907-69147929 CTGCCTACAGATAGTGTGTAAGG - Intergenic
909292717 1:73904070-73904092 ATTCCTACAAATAGAGTACAAGG - Intergenic
911309219 1:96272869-96272891 CTTCCCACTAATAGTGTGCAAGG + Intergenic
911761253 1:101619907-101619929 CTTGAAACAGATAAAGTGAAGGG + Intergenic
913119623 1:115727826-115727848 CTTACAACAGATAAAGAGCTCGG + Intronic
918469525 1:184857144-184857166 CTTCCAACAGATAGAGTGCAAGG + Intronic
918972446 1:191436896-191436918 CTTCCAAAAGATAGAGTAAGAGG + Intergenic
919359359 1:196571261-196571283 CTTCCAACAGATACTGTAAATGG - Intronic
922887226 1:229029308-229029330 CTCCCACCAGATACAGTGCCAGG - Intergenic
1065197386 10:23279565-23279587 GTTCCAAGAAATAGGGTGCACGG + Intronic
1066706063 10:38179156-38179178 CTTCTCACACATAGAGAGCATGG + Intergenic
1071427048 10:85569166-85569188 GTTCAAACAGCTAGAGTGAAAGG - Intergenic
1075740573 10:124693577-124693599 CTTCCACTAGACAGAGTGCACGG + Intronic
1080549040 11:33353185-33353207 CTTCCATGAGAAAGAGTGAATGG - Exonic
1080919194 11:36691968-36691990 CTTCCAAAACATAGATTCCATGG + Intergenic
1081281455 11:41213687-41213709 GTTATAACAGATAAAGTGCAGGG + Intronic
1084741446 11:71142083-71142105 TTTCAAAAAGAAAGAGTGCAGGG + Intronic
1085725017 11:78947598-78947620 CCTCCGACAGAGAGAGTGCGGGG + Intronic
1087336873 11:96854523-96854545 CTCCAAAGAGATAGAGGGCAAGG + Intergenic
1099585553 12:84508424-84508446 CTCCCAACAGGGAGTGTGCAAGG - Intergenic
1099847015 12:88040214-88040236 ATTCCAACAGAAAAAGTGGATGG + Exonic
1100179243 12:92066395-92066417 CTTACTACAGAAAGAGTGCATGG + Intronic
1101421044 12:104551351-104551373 ATTCCACCAGGTAGTGTGCAGGG + Intronic
1106189303 13:27437278-27437300 TTTGAAACAGATAGGGTGCAAGG + Intronic
1107265634 13:38550464-38550486 ATTCCAACAAATAGAGGGGAGGG - Intergenic
1110173852 13:72533731-72533753 GTTCCAACAGATACAATACATGG + Intergenic
1113328205 13:109303911-109303933 CATCCAGCAGGTAGAGTCCAGGG + Intergenic
1115669418 14:35592457-35592479 CTTCCAAAAAACAGAGTGAAGGG + Intronic
1117982553 14:61356386-61356408 ATTCTAACCGATAGAGTCCAGGG - Intronic
1118687680 14:68307532-68307554 CTTCCCACATATAGATTTCAGGG - Intronic
1119183173 14:72618001-72618023 CTTCCAACACACAGAGTTCTCGG + Intergenic
1121072910 14:91040941-91040963 CTTCCAGCAGATCCAGTGAATGG + Intronic
1122590727 14:102848728-102848750 TTTCCAACAAATAAAATGCAAGG - Intronic
1128175419 15:65551095-65551117 ATTCCAACAGGTAGAGGGAAGGG - Intronic
1130875330 15:88008854-88008876 CTTCCAGCAGGGAGAGTGAAGGG - Intronic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1131503775 15:92997851-92997873 CTTGCAACAGATAGGGTGGGAGG - Intronic
1134609630 16:15598069-15598091 GTTCCAACAGATGAAGAGCAGGG + Intronic
1136502083 16:30676667-30676689 CTTCCAACGGAAAGAAAGCAGGG + Intergenic
1136926368 16:34378504-34378526 CTTCTCACACATAGAGTGTATGG - Intergenic
1136978206 16:35033303-35033325 CTTCTCACACATAGAGTGTATGG + Intergenic
1139117316 16:63972148-63972170 CTTTGAACAGACAGAGAGCATGG - Intergenic
1141131307 16:81438991-81439013 CATCCAACAGGTAGAGGCCAGGG + Intergenic
1141312274 16:82925866-82925888 GTTCCAACAGATGGACTCCATGG - Intronic
1141998670 16:87650836-87650858 CTTCCAGAACATAAAGTGCAAGG + Intronic
1144419275 17:15081219-15081241 CTTGCAAAGGATAGAGTGGAAGG + Intergenic
1146204641 17:30892059-30892081 CATCCAACAGAAAAAGTGCAAGG - Intronic
1146489986 17:33273952-33273974 CTTCCCACAGAGTGATTGCAAGG - Intronic
1151354172 17:73548719-73548741 CTTCCCCCAGACAGTGTGCAAGG - Intronic
1155502974 18:26505321-26505343 CTTTAACCAGAAAGAGTGCAAGG + Intronic
1156636442 18:39036230-39036252 CTTTGAACAGGTAGAATGCAAGG + Intergenic
1159140118 18:64383661-64383683 CTTCAAACAGATGGTATGCATGG + Intergenic
1160044811 18:75376877-75376899 CTTCAAACACACAGAGGGCAGGG - Intergenic
1160617203 18:80140086-80140108 CTACCTAAAGATAGAGTGAAGGG - Exonic
1167678912 19:50907209-50907231 CTTCCAACAGATATGTTGCTGGG - Intronic
1168027671 19:53654907-53654929 CTTTGCATAGATAGAGTGCATGG - Intergenic
925599252 2:5591060-5591082 TTTCCCACAGATAAAGAGCAAGG - Intergenic
930042423 2:47137515-47137537 CTTTCAGAAGATAGAGGGCAGGG - Intronic
937697644 2:124825846-124825868 ATTCCAACAGATACAAAGCATGG - Intronic
938367740 2:130748192-130748214 ATTCCAACAGATAAAGTTCAAGG + Intergenic
938735378 2:134181220-134181242 CTTCCAGTAGGTAGAGTCCAGGG + Intronic
939014284 2:136884283-136884305 CTCCCAACTGATACAGTTCAGGG - Intronic
939408075 2:141785733-141785755 CTTGGAACTGATAGAGTCCAAGG + Intronic
943993895 2:194734442-194734464 TTTCCAACAGATAGAGTGCATGG - Intergenic
946838701 2:223798305-223798327 CTGCCACCAGATGGTGTGCAAGG - Intronic
946902959 2:224389959-224389981 CATCCAACTGATAGAGATCAGGG + Intronic
948356562 2:237382667-237382689 ATTCCATCAGATAGATTGCATGG + Intronic
948694567 2:239726728-239726750 CTTCCCACAGATTGAGAGCCAGG - Intergenic
948975877 2:241463641-241463663 CTTCCAGAAAAGAGAGTGCAAGG + Intronic
1169718027 20:8643117-8643139 CCTCCAACATATAGAGTTCAAGG + Intronic
1170262952 20:14431985-14432007 CTTACAACAGATAGTCAGCATGG - Intronic
1173196527 20:40918394-40918416 ATTCCCACCGATAGAGTGCAAGG - Intergenic
1173280756 20:41625387-41625409 CTTCCCACAGAGAGAGAACAAGG - Intergenic
1173906413 20:46633066-46633088 CTTCTAACATAAAGAGGGCAAGG - Intronic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1178637912 21:34321361-34321383 CTTCCAACAGATGCATAGCATGG + Intergenic
1179965872 21:44805024-44805046 CTTGCACCAGGAAGAGTGCACGG - Intergenic
950117451 3:10460517-10460539 CTTCCAACACCTAGGGTGCTGGG + Intronic
952771097 3:37001439-37001461 CCTTCAACAGATAGACAGCAGGG + Intronic
954229908 3:49208817-49208839 CTACCAACAGAGAGGGTACATGG + Intronic
955749941 3:62177507-62177529 CTTCTAACAGGAAGAGGGCATGG - Intronic
956639435 3:71401801-71401823 CTTCAAACAGACAAAGTGAATGG + Intronic
956776475 3:72569537-72569559 CTGGCAACAGAAAGAGTTCATGG - Intergenic
959015076 3:101124598-101124620 CTTCCAACAAATAGAGTTTGAGG - Intergenic
959325574 3:104932627-104932649 CTTCCAACAGGGAGAATACATGG + Intergenic
959712251 3:109396763-109396785 ATTCCAACAGAAAAAGTGGATGG + Intergenic
960304358 3:116043071-116043093 TTTCCAATAGATAGAGGCCAGGG - Intronic
966202524 3:177372193-177372215 CTTGCAACAGATATAGTGACTGG - Intergenic
966426910 3:179789637-179789659 CATCCAGCAGATAAAGTCCAAGG - Intergenic
967133176 3:186491389-186491411 CTTCTATCAGATAGATTCCAAGG - Intergenic
968330912 3:197869310-197869332 CTTCCTGCAGGTACAGTGCATGG - Intronic
969887473 4:10228454-10228476 CTTCCAAAAGTTAGGGTGGAAGG - Intergenic
971507492 4:27382037-27382059 CTTCCAACAGAGAGACTGGCAGG + Intergenic
972671315 4:41215745-41215767 TTTCAAACAGGTAGAGTGCTGGG + Intronic
975093549 4:70431394-70431416 CTTCAAACACAAAGAGTTCATGG + Intronic
975551715 4:75619661-75619683 TTGTCAACAGATAGAGGGCATGG - Intronic
975566049 4:75755364-75755386 CTTGCAACATATAGACTGAATGG - Intronic
981870603 4:149480868-149480890 CTTCCCACAAATAGTGTACAAGG + Intergenic
982694404 4:158582838-158582860 CTTGCACCAGAGAGAGTGGAGGG - Intronic
986207074 5:5635024-5635046 TTTTCACCAGATAGAGTGCTTGG + Intergenic
986463749 5:7999672-7999694 ATTCCCACAAATAGTGTGCAAGG + Intergenic
988414788 5:30932423-30932445 TTTCCAACAGATTGCATGCAAGG + Intergenic
989759381 5:44994331-44994353 ATTCCAACAGATAGTGTCCTGGG + Intergenic
990735473 5:58856255-58856277 CTCCAAACAGAGAGAGTGGAGGG + Exonic
991436988 5:66606742-66606764 CTTGCAACAGGGAGGGTGCATGG + Intronic
992985491 5:82224654-82224676 CTTCAAGGAGATAGAGTGAAAGG + Intronic
995940155 5:117571963-117571985 TTTCCAAGAGATATATTGCATGG - Intergenic
997299838 5:132795139-132795161 CTTTCAACAAATAAACTGCAAGG + Intronic
997640121 5:135443507-135443529 CTTCCAGCAGTTAGAGTGCTTGG + Intergenic
998989933 5:147804418-147804440 CCTCCAGCAGACAGAGGGCAAGG - Intergenic
1000662831 5:163956980-163957002 CTACCAACAGATATACTTCATGG - Intergenic
1001767739 5:174266064-174266086 ATTCCAAAAGATAGAGTAAAAGG + Intergenic
1002630968 5:180578088-180578110 CTTCCAAAGGGAAGAGTGCAGGG + Exonic
1003030256 6:2595271-2595293 CTCCCACCTCATAGAGTGCATGG - Intergenic
1003164274 6:3662592-3662614 TTTCCAACAGGTAAACTGCAAGG + Intergenic
1003828474 6:9978214-9978236 TTTCCAATAGATAAACTGCATGG + Intronic
1005898776 6:30199427-30199449 TTTCCAACAGATAGAAGGAAAGG - Intronic
1006392802 6:33768721-33768743 CTTCCCAGAGATAGCCTGCAGGG + Intergenic
1009052712 6:58297003-58297025 CTTCCTACAGAGAAAATGCAAGG + Intergenic
1009238394 6:61153580-61153602 CTTCCTACAGAGAAAATGCAAGG - Intergenic
1013178253 6:107695342-107695364 GTTCCCACAGGTAGAGAGCAAGG - Intergenic
1015643985 6:135366322-135366344 ATTCCAAAAGATAGAGAACAAGG - Intronic
1018221639 6:161586643-161586665 ATTTCAACAGAAAGAATGCAAGG - Intronic
1018224201 6:161612137-161612159 CCTCCATCACATAAAGTGCAAGG + Intronic
1018642215 6:165915072-165915094 CTTTCAACAAATAGCATGCATGG + Intronic
1020071901 7:5232692-5232714 CTCCCAGGAGATGGAGTGCACGG - Exonic
1021629632 7:22631796-22631818 CTGCCAACAGCCAGAGAGCATGG - Intronic
1021936171 7:25633759-25633781 TTTCCAACAGTTACAGTTCACGG - Intergenic
1024569940 7:50715084-50715106 CCTCCCACAGGTAGAGGGCAGGG + Intronic
1024580349 7:50795906-50795928 CTTCCAGCAGGTGGAGTGCCTGG + Intergenic
1027541218 7:79468603-79468625 ATCCCAACAGATAGAGTCTATGG + Intergenic
1028347809 7:89804759-89804781 ATTCCAAAAGATAGAGAGAAAGG - Intergenic
1028723208 7:94057848-94057870 CTTGCCAAATATAGAGTGCAGGG - Intergenic
1032927693 7:136627346-136627368 ATTCCCACCAATAGAGTGCAAGG + Intergenic
1033947415 7:146738123-146738145 ATTCCCACAAATAGTGTGCATGG + Intronic
1034761641 7:153678290-153678312 CTCCCAAAAGACAGAATGCATGG - Intergenic
1038007964 8:23450103-23450125 CTTCCAACAGCTTCAGTGCAAGG - Intronic
1039161000 8:34619803-34619825 CTTCCAACAGAGAGAAATCAAGG - Intergenic
1040580095 8:48690593-48690615 CTTTCAGCAGAGAGAGCGCAGGG - Intergenic
1041662855 8:60415801-60415823 CTTTCAACAGACAGATTTCAAGG + Intergenic
1042892060 8:73622919-73622941 CTTCCAGCAGTTAGAAGGCAAGG - Intronic
1044906664 8:97011514-97011536 CTTCCAAAAGATAAACTGCATGG - Intronic
1047191428 8:122682440-122682462 CTTCCAACCCAGAGATTGCACGG - Intergenic
1050692679 9:8245692-8245714 CATCCAGCAGATAGAATGCCTGG - Intergenic
1058220282 9:102291024-102291046 TTTCCATCAGATAGAGAGAAAGG - Intergenic
1186042547 X:5496925-5496947 CTTCTAACAGATAAAGTGCAAGG + Intergenic
1186675311 X:11810563-11810585 CTTCCAACAGAATGAATGAAAGG - Intergenic
1190164361 X:48060191-48060213 CTTCCTTCAGACAGAGTGAAAGG - Exonic
1198261836 X:134972006-134972028 CTCCCAACAGATACAGATCAGGG - Intergenic
1201545711 Y:15159661-15159683 CTTCTAACATATAAAGTGCAAGG - Intergenic