ID: 918471914

View in Genome Browser
Species Human (GRCh38)
Location 1:184884075-184884097
Sequence CAGAACATGGGGCAGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918471914_918471927 21 Left 918471914 1:184884075-184884097 CCAGATAACTGCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 918471927 1:184884119-184884141 CTGCCTGAAAACCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 282
918471914_918471929 26 Left 918471914 1:184884075-184884097 CCAGATAACTGCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 918471929 1:184884124-184884146 TGAAAACCAGCAAGCAGGTGAGG 0: 1
1: 0
2: 1
3: 30
4: 281
918471914_918471921 -3 Left 918471914 1:184884075-184884097 CCAGATAACTGCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918471914 Original CRISPR CAGAACATGGGGCAGTTATC TGG (reversed) Intronic
900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG + Intergenic
902599548 1:17531793-17531815 CAGAACAATGGGCTCTTATCCGG - Intergenic
903884474 1:26532807-26532829 CAGAACTGGGGGCAGTGGTCTGG + Intronic
911537411 1:99116850-99116872 CAAAACATGGGGGAATTATGGGG + Intergenic
913475471 1:119232897-119232919 AAGAATTTGGGGCAGTTACCAGG - Intergenic
915138346 1:153749909-153749931 TAGAAAACAGGGCAGTTATCTGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
922051274 1:221992888-221992910 CACATGATGGGGCAGTGATCAGG + Intergenic
922075436 1:222238998-222239020 CAGGACATGGGGCAGGTAGCTGG - Intergenic
1063151852 10:3344321-3344343 CAGCACATGTGGCTGTTACCCGG + Intergenic
1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG + Intergenic
1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG + Intronic
1067156255 10:43783453-43783475 CAGTACAGGGAGCAGTTCTCTGG - Intergenic
1068409096 10:56631896-56631918 CAAAACATGGCTCAGTTCTCAGG - Intergenic
1079799813 11:24854712-24854734 CACAAAATGGGGCAGTTGTTTGG - Intronic
1083783785 11:64932295-64932317 CAGAACATGAGTTAGTTAGCTGG - Intronic
1086744993 11:90413908-90413930 TAGAAGATGAGGGAGTTATCTGG + Intergenic
1087709269 11:101530601-101530623 CAGAAAATGGGCCTGTTACCAGG - Intronic
1102633004 12:114298681-114298703 CAGAAGATGGAGGGGTTATCTGG - Intergenic
1102928666 12:116845942-116845964 AAGAACATTTGGCAGTTAACTGG - Intronic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1112093174 13:96104666-96104688 CAGGCCCTGGGGCAGTTGTCTGG - Intronic
1112557932 13:100486113-100486135 CAGAGAATGAGGCAGTTTTCAGG - Intronic
1117387524 14:55230959-55230981 AAGAACCTGGGGTAGGTATCTGG + Intergenic
1123082525 14:105702460-105702482 CAGAACATGGCCCAGTGATCAGG + Intergenic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1130445905 15:84001732-84001754 CATACCATGGGGCAGTCCTCAGG - Intronic
1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG + Intergenic
1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG + Intronic
1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG + Intergenic
1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG + Intronic
1140741299 16:77943813-77943835 CATAGCATGTGGCAGTTATTAGG + Intronic
1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG + Intergenic
1145010968 17:19367744-19367766 CAGAGGAAGGGGCATTTATCGGG - Intronic
1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG + Intergenic
1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG + Intronic
1147979671 17:44266735-44266757 CAAAACTTGGGGCAGCGATCTGG - Intronic
1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG + Intronic
1148709191 17:49664705-49664727 TTGAACCTGGGGCAGGTATCTGG + Intronic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1154521880 18:15238853-15238875 CAGAACCTGTAGCAGTGATCTGG - Intergenic
1157134545 18:45040922-45040944 CAGCACCTGGGGTAGATATCTGG - Intronic
1158670033 18:59466316-59466338 CAATACAAGGGGCAGTTCTCCGG + Intronic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1160117719 18:76097463-76097485 AAGAGCATGGGCCAGTTATGTGG - Intergenic
1162241098 19:9354988-9355010 CAGATCATGGGGCAGGAATTTGG - Intronic
929285023 2:40126164-40126186 CAGAGCATGGAGTTGTTATCTGG - Intronic
935162323 2:100539998-100540020 CAAACCATTGTGCAGTTATCTGG - Intergenic
937439518 2:121904276-121904298 CAGAAAATGGGGATGTTAACAGG + Intergenic
938521245 2:132072583-132072605 CAGAACCTGTAGCAGTGATCTGG - Intergenic
938585501 2:132686409-132686431 GACAACAAGGGGCAGTCATCAGG - Intronic
938644975 2:133321085-133321107 CAAGACATGGGTCAGTGATCAGG - Intronic
938921335 2:135997853-135997875 GAGTCCTTGGGGCAGTTATCAGG - Intergenic
939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG + Intronic
939168679 2:138667999-138668021 CACTACATTGGGCAGTTTTCAGG - Intergenic
939673829 2:145046991-145047013 CAGATCATGGTGCATTTAGCAGG - Intergenic
939998568 2:148943667-148943689 CAGCACTTGGGGCAGCTATAAGG - Intronic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG + Intronic
948122305 2:235540002-235540024 CAGGACATGGGACAGTTCCCTGG - Intronic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1173878814 20:46395080-46395102 CAGAAAATGGGGAAGATAACTGG + Intronic
1176084835 20:63291144-63291166 CAGACCACGTGGCAGTGATCCGG - Intergenic
1176282224 20:64320123-64320145 CAGAGCATGGGGCCCTTCTCTGG + Intergenic
1178825086 21:36008543-36008565 CAATACATGGGACAGATATCTGG - Intergenic
952178347 3:30891504-30891526 CAGAATATGGGCCAGTGACCTGG - Intronic
952475848 3:33709816-33709838 CACAACATGTGGCTGTTATTTGG + Intronic
953166160 3:40466634-40466656 CACAATATGAGGCAGGTATCAGG - Intergenic
954353507 3:50065321-50065343 GAGAACCAGAGGCAGTTATCTGG + Intronic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
962848975 3:139293808-139293830 CACAACATGGGGTTGTTATCAGG + Intronic
967702640 3:192611338-192611360 CAGAAAAGGAGGCTGTTATCAGG + Intronic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
970208250 4:13678730-13678752 CAGAACAGGGGTCAGTGAACTGG - Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
972937348 4:44153948-44153970 TAGAACATGGTGCAGTCATAAGG + Intergenic
976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG + Intronic
979602626 4:122603293-122603315 TGGAACATAGGGCAGTTGTCAGG - Intergenic
980119532 4:128713666-128713688 CAGAACATGGTGCTGGCATCTGG + Intergenic
980701394 4:136436397-136436419 CAGAATATGCTGCAGCTATCAGG - Intergenic
982601133 4:157451132-157451154 CAGAAGATGTGTCAGTTTTCTGG - Intergenic
984421722 4:179531556-179531578 CATAACATTGGCCAGTTATTTGG + Intergenic
988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG + Intergenic
992979792 5:82157035-82157057 CAGCACATCTGGCAGTTTTCTGG - Intronic
995443991 5:112222719-112222741 CAGCAGATGAGTCAGTTATCTGG - Intronic
998904481 5:146889788-146889810 CAGAAGTTAGGGCAGTTTTCGGG + Intronic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1000343958 5:160298842-160298864 CAGAATATAGGACATTTATCAGG + Intronic
1001745287 5:174087987-174088009 CAGAACAATGGGCAGTAAACAGG + Intronic
1003419635 6:5945442-5945464 CAAAACTTGGGACAGTTGTCAGG + Intergenic
1007287190 6:40756054-40756076 CAGATCATGGGGTTGTTATAAGG - Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1008767397 6:54935479-54935501 AAGATCCTGGGGCAGATATCTGG + Intronic
1010051083 6:71505134-71505156 CAGAACATGAGGGAGATCTCAGG + Intergenic
1010120117 6:72365354-72365376 CAGAACTTGGAGTATTTATCTGG - Intronic
1010830260 6:80518781-80518803 AAGAAAATGGGGCAGTGATGTGG - Intergenic
1012665637 6:101964890-101964912 GAGAACATGTGGCAATTAGCAGG + Intronic
1012997097 6:105984933-105984955 CTGAAGATGGGGCAGATATAGGG + Intergenic
1015369873 6:132438571-132438593 GAGAACCTGGGGCAGTCAGCAGG + Intergenic
1017118308 6:150999936-150999958 CAGAACATGAGGAAGTTACTGGG - Intronic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1022496322 7:30855210-30855232 TGGAAGATGGAGCAGTTATCAGG + Intronic
1026451633 7:70534366-70534388 CAGAATATCGGGGAGTTATTGGG + Intronic
1026473533 7:70714674-70714696 CAGAATGTGGGGCAGTCTTCAGG - Intronic
1029113704 7:98226000-98226022 CAGCACATAGGGCAGTTCTGGGG + Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1034231499 7:149532204-149532226 CAGAAGATGCAGCAGTTATAAGG - Intergenic
1035650544 8:1260824-1260846 CAGAGCATGGGGAGGTGATCTGG + Intergenic
1035831615 8:2700999-2701021 CAGCACATCCGGCAGTTTTCTGG + Intergenic
1036649639 8:10634134-10634156 CATAACATGGTACAGTTATCAGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037709373 8:21343460-21343482 CAGAACAAGGGACAGTGATTAGG - Intergenic
1037987946 8:23301331-23301353 CAGAACATGCCGCTGTTTTCAGG + Intronic
1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG + Intergenic
1039916998 8:41867482-41867504 CATCACTTGGGGCTGTTATCAGG - Intronic
1044190747 8:89314318-89314340 AGGAATATGGGGCAGTTCTCTGG - Intergenic
1047156361 8:122323735-122323757 CTGAATATGAGGCAGTAATCTGG - Intergenic
1047160416 8:122371573-122371595 GAGAATATGGGGCAGTGTTCAGG + Intergenic
1058843385 9:108932935-108932957 AAGAAAATGAAGCAGTTATCAGG - Intronic
1059233516 9:112742766-112742788 CAGAACCTGGGGCAAGGATCTGG + Intergenic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1185543198 X:920555-920577 CAGAACATGAGGCAGGGAGCCGG - Intergenic
1189212543 X:39296110-39296132 AAGAACATGGCACAGTCATCTGG + Intergenic
1189577243 X:42367360-42367382 CACAACATAGGGCAATTATAAGG + Intergenic
1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG + Intronic
1193083558 X:77428305-77428327 CAGAGCCTGGGCCAGGTATCTGG - Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1201650997 Y:16286390-16286412 CAGAACATGCAGCATTTAACAGG - Intergenic