ID: 918471921

View in Genome Browser
Species Human (GRCh38)
Location 1:184884095-184884117
Sequence CTGCTTCACCGGGGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918471913_918471921 8 Left 918471913 1:184884064-184884086 CCAACTTGCAGCCAGATAACTGC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217
918471911_918471921 10 Left 918471911 1:184884062-184884084 CCCCAACTTGCAGCCAGATAACT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217
918471910_918471921 11 Left 918471910 1:184884061-184884083 CCCCCAACTTGCAGCCAGATAAC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217
918471912_918471921 9 Left 918471912 1:184884063-184884085 CCCAACTTGCAGCCAGATAACTG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217
918471909_918471921 12 Left 918471909 1:184884060-184884082 CCCCCCAACTTGCAGCCAGATAA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217
918471914_918471921 -3 Left 918471914 1:184884075-184884097 CCAGATAACTGCCCCATGTTCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918471921 Original CRISPR CTGCTTCACCGGGGCCTCCC AGG Intronic
900378670 1:2373064-2373086 CTGCTCCACCGGGGCCTGCAGGG + Intronic
900521813 1:3109540-3109562 ATGCTTCACTAGGGCCTCCCAGG - Intronic
900706366 1:4082621-4082643 ACGCTCCACCGGGGCTTCCCCGG - Intergenic
900796659 1:4712295-4712317 CTGCTGCTCCGGGGCCCCACCGG - Exonic
901027135 1:6284702-6284724 CTGCAGCATCGAGGCCTCCCTGG + Intronic
901146196 1:7066226-7066248 CAGCATCACAGGGGCATCCCTGG + Intronic
901632283 1:10653712-10653734 CTGCTGCCCCAGGGCCTGCCTGG - Exonic
901938889 1:12646808-12646830 CTCCGGCACTGGGGCCTCCCAGG + Intronic
902330167 1:15727397-15727419 CGGCCTCTCCGGGGCATCCCCGG - Exonic
903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG + Intergenic
903298748 1:22363143-22363165 CTTCTTCCACGGGGCCTCCCAGG + Intergenic
903669315 1:25026066-25026088 CTGCTTTAGCATGGCCTCCCTGG - Intergenic
904093557 1:27961013-27961035 CTTCTTGACCTGGGCCTCCCTGG + Intronic
905405767 1:37731460-37731482 CCGCTTCCCCGGGGCCATCCTGG - Exonic
905822443 1:41004124-41004146 ATGCTGCACTGGGGCCACCCTGG + Intronic
906078621 1:43069299-43069321 CAGCCTCACCCTGGCCTCCCAGG + Intergenic
912646125 1:111393901-111393923 CTGCTTCACCTGACCCTCCATGG - Intergenic
917701580 1:177587193-177587215 CTGTTTCACTGCAGCCTCCCAGG - Intergenic
918471921 1:184884095-184884117 CTGCTTCACCGGGGCCTCCCAGG + Intronic
919743117 1:200992372-200992394 CTGCTTCATCAGGGCCACCTGGG + Exonic
921955760 1:220981789-220981811 CTGCTTAATCCTGGCCTCCCAGG - Intergenic
922734094 1:227970411-227970433 CTTCCTCACCGTGGCCTCCTGGG + Intergenic
1064012019 10:11742813-11742835 CCGGTTCCCCGGGTCCTCCCCGG - Intronic
1067765144 10:49080286-49080308 CTGCTTCTCCAGGCTCTCCCTGG - Intronic
1070571781 10:77645422-77645444 TTGTTTCACAGTGGCCTCCCTGG + Intergenic
1071347150 10:84703579-84703601 CTGCTCCAAAGGGGCTTCCCAGG + Intergenic
1073729194 10:106270036-106270058 CTGCCTCACTGGGTCCACCCAGG + Intergenic
1076058975 10:127398467-127398489 CTGCTAGTCCTGGGCCTCCCTGG + Intronic
1076310941 10:129507130-129507152 CTGTTTCACCCGGTCCTCACAGG - Intronic
1076335956 10:129706579-129706601 ATGCTTCCCCGGGACTTCCCAGG - Intronic
1076539724 10:131206420-131206442 CTGCCTCACCTGAGCCTTCCTGG + Intronic
1076744855 10:132507732-132507754 CTCCCTCACCGTGGCCTCCAGGG - Intergenic
1076868279 10:133180021-133180043 CTGCTGCCCTGGGGCCTCCGAGG + Intronic
1077104765 11:837381-837403 GTGCATCCCCAGGGCCTCCCTGG + Intronic
1081528501 11:43942825-43942847 CCGCTGCGCCGGGGCCCCCCGGG - Exonic
1084153033 11:67299985-67300007 CTGCTGCACGGGGGCCTGCGTGG - Exonic
1085388674 11:76171311-76171333 CTGCTCCATCGGGCCCTTCCAGG - Intergenic
1087672921 11:101128216-101128238 CTGCTCCACCAGGGCGACCCTGG + Exonic
1090062012 11:123472431-123472453 CTGCTTCACCGGGGAGGCCGAGG - Intergenic
1091122106 11:133065207-133065229 CTGCTTCACTGGGGCCTCCGGGG + Intronic
1091278025 11:134365308-134365330 CTGCGTCACAGGAGCCTGCCTGG - Intronic
1093597731 12:20981707-20981729 CTGCTTCAGCTGGCCCTCCATGG + Intergenic
1095982957 12:47983119-47983141 CAGCTTCACCGGGAACACCCTGG + Exonic
1097234324 12:57529172-57529194 CTGCCTCCCCGGGCCCGCCCTGG + Exonic
1102214335 12:111149600-111149622 CTGCTTTAACGGGGGCTTCCTGG + Intronic
1103441132 12:120963799-120963821 CTGCTTCACCTTGGCCTACAAGG - Intergenic
1103700842 12:122848059-122848081 CTCCTTCACGGGGGCCTCCTGGG - Exonic
1103856350 12:123973174-123973196 CCGCTCCCCCGGGGCTTCCCCGG + Exonic
1104018551 12:124976322-124976344 GTGATTGACCGGGGACTCCCAGG - Intronic
1104941952 12:132399392-132399414 CTCCTGCACCAGGGCCTTCCTGG + Intergenic
1105413973 13:20193227-20193249 CCGCTTCACCCGGGCCGCCAAGG - Intergenic
1106942446 13:34793322-34793344 TTGTTTCACCAGGGCTTCCCTGG - Intergenic
1107399731 13:40057538-40057560 CTGCTTCTCCAGGTCCTCACTGG + Intergenic
1109370269 13:61413726-61413748 CTCCTTCAGCCTGGCCTCCCGGG - Exonic
1113668537 13:112159147-112159169 CTGGTTTACCAGGACCTCCCCGG - Intergenic
1113695770 13:112344114-112344136 ATGCTTCGCAGGGGCCTCCATGG - Intergenic
1114502586 14:23182067-23182089 GAGCTTCACCGGGTCCTCCGTGG + Intronic
1117410670 14:55448156-55448178 CTGCTTCTCCAGGACCTCACAGG - Intronic
1118885219 14:69860322-69860344 CTTCTGCACCGGGGTTTCCCTGG + Intronic
1118894229 14:69932353-69932375 CTGCTGCGCTGGGGCCTTCCGGG + Intronic
1119147650 14:72331542-72331564 CTGCCTCACCTGGGGCTCCAGGG + Intronic
1119575544 14:75718128-75718150 CTGCTTCTCCATTGCCTCCCCGG + Intronic
1122503922 14:102219622-102219644 GTGCTTGACCAGGGACTCCCTGG - Intronic
1122813406 14:104300214-104300236 CTCCTCCACCGGGGCCAGCCAGG - Intergenic
1124664819 15:31583348-31583370 GTGCTTCACAGGAGCTTCCCTGG - Intronic
1124885219 15:33678957-33678979 GTGCTTCCCCAGGGCCTCTCTGG - Intronic
1125506778 15:40271869-40271891 CTGCCTCACGGCAGCCTCCCTGG + Intronic
1126545937 15:49874305-49874327 TTTCTTCAGAGGGGCCTCCCTGG - Intronic
1127674873 15:61229120-61229142 CTGGTTCAGCGGGGTCTCCCTGG + Intronic
1128318484 15:66676400-66676422 CTGCTTCACCAGGAGCTCCTTGG - Intronic
1128879889 15:71233345-71233367 CTGCTTCAACTGAGCCTCACTGG + Intronic
1132778963 16:1612609-1612631 CTGGCTTCCCGGGGCCTCCCCGG - Intronic
1132930004 16:2454240-2454262 CTGCTTCCCCAGGGCTCCCCAGG - Intronic
1133021261 16:2967918-2967940 CTGCTCCCCCGGGGACCCCCAGG + Exonic
1136237637 16:28924717-28924739 CTCCTTCACCTGGGCCCGCCCGG + Intronic
1136579602 16:31143416-31143438 CACCATCACCTGGGCCTCCCAGG + Exonic
1136684562 16:31986605-31986627 CTGCCTGCCCTGGGCCTCCCAGG + Intergenic
1138752627 16:59442222-59442244 CTGCTTCTACAGGGCCACCCTGG - Intergenic
1139652833 16:68371267-68371289 CCCCTTCACCAGGGACTCCCGGG + Exonic
1140903908 16:79394414-79394436 CTCCCTCCCCTGGGCCTCCCAGG + Intergenic
1141632659 16:85296931-85296953 CTGCTCCCCCGGCGCTTCCCCGG + Intergenic
1141679732 16:85537059-85537081 CGGCTTCACTGGAGCCTTCCTGG - Intergenic
1142100198 16:88266976-88266998 CTGCTGCTCCAGGGCCCCCCTGG - Intergenic
1142115260 16:88353013-88353035 CAGTCTCACCGGGGCCTGCCTGG - Intergenic
1142128391 16:88421318-88421340 GTGCTCCTCCGGGGTCTCCCTGG + Intergenic
1142157392 16:88538849-88538871 CTGCTTGACCTCTGCCTCCCAGG + Intergenic
1142174489 16:88638969-88638991 CTGTTTCACCAGCTCCTCCCCGG + Exonic
1142228301 16:88888078-88888100 CTGATTCACCCGGAGCTCCCCGG - Intronic
1142277890 16:89132550-89132572 ATGCTTAACAGGGGCCTCCAGGG + Intronic
1142358587 16:89615685-89615707 CCAGTTCACCGGGGCCTCGCGGG - Intronic
1142378839 16:89720826-89720848 CGGCTTCACCGTGCCGTCCCCGG + Exonic
1142849060 17:2695607-2695629 GTCCTTCTCCAGGGCCTCCCAGG - Intronic
1142852502 17:2711136-2711158 CTGCTCCGCGGCGGCCTCCCAGG - Intronic
1142899308 17:3002534-3002556 CTGCTTCACCCAGGCCCCCTGGG - Intronic
1143190327 17:5035520-5035542 CTGCCTCAGGGGGGCATCCCGGG + Intronic
1143416610 17:6755555-6755577 CTGCATCCCCAGAGCCTCCCTGG + Intronic
1143515427 17:7417280-7417302 CCGCTTCCCCGGGGACTCACGGG + Exonic
1144754465 17:17670753-17670775 CAGCTGCACAGAGGCCTCCCAGG + Intergenic
1147393346 17:40122866-40122888 CTGCTGCCCGGGGGCCGCCCCGG - Intronic
1149886247 17:60342901-60342923 CTGCTTCACCTCGCCCTCCGTGG + Intronic
1151403092 17:73868914-73868936 GTGCCTCAGCAGGGCCTCCCTGG - Intergenic
1152072573 17:78141122-78141144 CTGCCTCCCCGAAGCCTCCCTGG + Exonic
1152214646 17:79025084-79025106 TTGCTTCCCCGGGGCCCTCCTGG + Intronic
1152566019 17:81100796-81100818 CTGCTCCAGAGTGGCCTCCCTGG + Intronic
1153814912 18:8783717-8783739 CAGCTTCAGCTCGGCCTCCCGGG - Exonic
1154044263 18:10889667-10889689 CTGCTTCACCTGTACCTTCCAGG - Intronic
1154161179 18:11981656-11981678 CGGCTTCATCGCGGCCTCGCCGG - Exonic
1158853285 18:61517427-61517449 CTGCTTCAGCTTGCCCTCCCTGG - Intronic
1160708943 19:541931-541953 CCGCTACACCTGGGCCTCCCAGG - Exonic
1161025311 19:2034020-2034042 CTGCTCCACCTGGGTCTCCCCGG + Intronic
1163126653 19:15247876-15247898 TGGCCTCACCAGGGCCTCCCGGG - Intronic
1164761310 19:30730343-30730365 CTCCTTCACCGGGCACTCCTAGG - Intergenic
1165046362 19:33108128-33108150 CTGCATTTCCGTGGCCTCCCGGG + Intronic
1165466725 19:35979052-35979074 CTGATTCCCCGTGGCCTCCATGG + Intergenic
1166785289 19:45363689-45363711 CTGCATAACCGGGACCTGCCGGG + Intronic
1167246056 19:48373810-48373832 CTGGCTCCCCAGGGCCTCCCGGG + Intronic
925337366 2:3108166-3108188 CTGCTGCCCTGAGGCCTCCCGGG - Intergenic
925644118 2:6018470-6018492 CTGCTTCCCCAGGGGCTCTCGGG + Intergenic
927138236 2:20112877-20112899 CAGCTTCAGCTGGGCCTCCGTGG - Intergenic
928127501 2:28626628-28626650 CTGCTGCCCCAGGCCCTCCCTGG + Intronic
929913639 2:46115297-46115319 CTGCTTCACAGGGACCTGGCAGG - Intronic
934762851 2:96865903-96865925 CTTCTCCACGGGGGCCTCCCAGG + Exonic
935060335 2:99601629-99601651 CTGCTTCCCGGGGGCCTCGCGGG - Intronic
936018944 2:108980272-108980294 GTGACTCACCTGGGCCTCCCTGG - Intronic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
937333166 2:121044642-121044664 CTCCTTCACCGGGGCCTGTGTGG - Intergenic
937930527 2:127201550-127201572 CTTCTTCATCTGTGCCTCCCAGG - Intronic
944440457 2:199738019-199738041 CTGCTTCACTGGGTTCTCACAGG + Intergenic
947096231 2:226570284-226570306 CTGTCTCACGGGGGCCTGCCTGG + Intergenic
947415068 2:229886572-229886594 CTGCCTCACCTCAGCCTCCCGGG + Intronic
948759682 2:240182929-240182951 CTGCTCCCTCAGGGCCTCCCAGG - Intergenic
948863123 2:240762552-240762574 CTGCTTCCACGGTGCTTCCCAGG + Intronic
948897512 2:240934211-240934233 ATGCTCCTCCTGGGCCTCCCTGG + Intronic
1169558141 20:6770160-6770182 CTGCTTCCCCAGGTCCTCCTGGG + Exonic
1170530697 20:17288122-17288144 CTCCTTCACCAGGCCCTTCCAGG + Intronic
1172427409 20:34864373-34864395 CTGCTACACCAGAGCCGCCCAGG - Intronic
1173308634 20:41875649-41875671 CTGCTTCACCGCTTCCTCACTGG + Intergenic
1173603225 20:44310802-44310824 CAGCTACCCCGGGGCCTCCCAGG + Intronic
1174053739 20:47784902-47784924 CTGCTTCCCCGAGTCCTGCCCGG + Intronic
1174530391 20:51208163-51208185 CTGCTTCCCCTGGGCCTTCTTGG - Intergenic
1174842379 20:53912283-53912305 CTGCTGCAAAGGGGCATCCCAGG - Intergenic
1175089299 20:56488829-56488851 CTGCTTTCCCTTGGCCTCCCTGG + Intronic
1176431716 21:6580083-6580105 CTGACTCACTGAGGCCTCCCTGG + Intergenic
1178397963 21:32259307-32259329 CTGCCTCGCCTTGGCCTCCCAGG + Intergenic
1178486477 21:33022962-33022984 CTGCTTCCCGGGTCCCTCCCGGG - Intergenic
1179707110 21:43187545-43187567 CTGACTCACTGAGGCCTCCCTGG + Intergenic
1179988266 21:44932789-44932811 CTGCTTCCCCGCGGCCGCCCCGG - Intergenic
1180070219 21:45432171-45432193 CTGCCCCAGCAGGGCCTCCCTGG + Intronic
1180079136 21:45478323-45478345 CGTCTTCACCGGGGTCGCCCTGG - Exonic
1180663112 22:17486398-17486420 CAGCATCACGGGGGCCTCCTCGG - Intronic
1181162259 22:20965787-20965809 CTGCTCCACCTGACCCTCCCAGG - Intronic
1181275403 22:21684870-21684892 CTTCTTCTCCGGGGCCTTCATGG - Exonic
1181829233 22:25546161-25546183 CTGCTTCCCATGAGCCTCCCTGG + Intergenic
1182309258 22:29393072-29393094 CTGCATCCCCTGTGCCTCCCTGG - Intronic
1182393667 22:30020022-30020044 CTGCTCCACAGGGACCTCCAGGG - Exonic
1183699593 22:39443596-39443618 CTGCCTCAGCCAGGCCTCCCAGG + Intergenic
1184102327 22:42347396-42347418 CTGCTGGAGCAGGGCCTCCCTGG - Intergenic
1185254791 22:49826393-49826415 CTGCTTCACCGCTTCCCCCCTGG + Intronic
950634595 3:14305997-14306019 CTGTGTCAGCGTGGCCTCCCTGG - Intergenic
951262628 3:20528909-20528931 CTTCTTCACCGTGGCCTGCTGGG + Intergenic
953544412 3:43853832-43853854 CTGCCTCAAAGAGGCCTCCCAGG + Intergenic
954638658 3:52085242-52085264 CTCCTGCACTAGGGCCTCCCAGG + Intronic
954751417 3:52816233-52816255 CTGCTTCACAGTGGCCTTCCAGG - Intronic
961602673 3:128073301-128073323 CTGCTTTACCACTGCCTCCCTGG + Intronic
963724880 3:148908758-148908780 CTGCTTCAGCAGGGCCTCCTGGG + Intergenic
968477318 4:818144-818166 CAGCTGCACTGGGGCCTCTCGGG - Intronic
968663875 4:1810325-1810347 CTGCCCCACCAGGGGCTCCCTGG + Intergenic
969460658 4:7327076-7327098 CTGCTTCACGGGGGGCTGGCAGG + Intronic
969878757 4:10155953-10155975 CTGCTTTCCCTGGGCCACCCTGG + Intergenic
971254706 4:25003756-25003778 CCGCTTCATCGGGGACTCCCGGG - Exonic
976589321 4:86833387-86833409 CTGTTCCACCGTGGCCGCCCTGG - Exonic
976593939 4:86876373-86876395 CTGCTTCTCCTGGGCCGCCCAGG - Intronic
978908724 4:114040733-114040755 CTGTTTCAGGGTGGCCTCCCAGG - Intergenic
979259258 4:118633311-118633333 CTTCCTCACCGTGGCCTCCTGGG + Intergenic
979329089 4:119407248-119407270 CTTCCTCACCGTGGCCTCCTGGG - Intergenic
985253813 4:188049680-188049702 CTGCTTCACAGGGGTGTCCCAGG - Intergenic
988698712 5:33650632-33650654 CTGCTTCACTGGGTCAGCCCTGG - Intronic
994874786 5:105405353-105405375 TTGTTTCACCTGGGCCACCCTGG - Intergenic
995610988 5:113910060-113910082 CTGATCCACAGGGGCCTCCCAGG - Intergenic
1001522233 5:172403013-172403035 CTCCTTGGCCAGGGCCTCCCTGG + Intronic
1002081622 5:176740860-176740882 CGCCTTCCCCGGGGCCCCCCAGG - Intergenic
1002169151 5:177365847-177365869 CTCCTCCACCTGGGCATCCCCGG - Intronic
1002182619 5:177438769-177438791 CTGCCTCACATGGGCCTCACTGG + Intronic
1002425516 5:179172351-179172373 CTGCTTCACTGGGGCCATGCTGG - Intronic
1003569538 6:7246991-7247013 CTTTTCCGCCGGGGCCTCCCCGG - Exonic
1004214498 6:13689042-13689064 CTGCTTCAGCTTAGCCTCCCAGG - Intronic
1004570941 6:16844290-16844312 CTGCTCCAGCGGGTGCTCCCTGG - Intergenic
1006251943 6:32795037-32795059 CTGCTTCTCCTGGTCCTACCTGG + Intergenic
1006406914 6:33850837-33850859 CTGCTCCACCAGCACCTCCCAGG + Intergenic
1006516946 6:34550468-34550490 CTGCTTCCCCAGGGTCTCCAAGG + Intronic
1006800316 6:36755723-36755745 CTGCTTAACCGTGACCTTCCTGG - Intronic
1006925189 6:37650119-37650141 CAGCTGCACCTGGGCCTCACGGG + Exonic
1007154087 6:39725299-39725321 CTGCTTCACCATCTCCTCCCTGG + Exonic
1012979376 6:105813621-105813643 CTGCCTCTCCTGGGCCTCCCTGG + Intergenic
1017632270 6:156408000-156408022 CTGATTGTCCTGGGCCTCCCCGG + Intergenic
1017824542 6:158071724-158071746 CTCCTTCACCTGGGACTGCCCGG - Exonic
1018060929 6:160089131-160089153 CTACTTCAGCTGGGACTCCCGGG + Exonic
1018967618 6:168500784-168500806 CTGCTTCACAGTGGCCGCCGAGG + Intronic
1019146084 6:169976449-169976471 CTGCCGCAGCAGGGCCTCCCAGG - Intergenic
1020178112 7:5898834-5898856 CTGCTTCTCCTGGGCCGCCCAGG - Exonic
1020304815 7:6826141-6826163 CTGCTTCTCCTGGGCCGCCCAGG + Exonic
1023401108 7:39793376-39793398 TTGCCCCACCGCGGCCTCCCGGG - Intergenic
1024629978 7:51238862-51238884 CTCCTTCACCGGGGACTCCCGGG - Intronic
1025025422 7:55512736-55512758 CTGCAGCACTGGGGCCTTCCAGG - Intronic
1025912409 7:65839342-65839364 CTGCCTCACCACAGCCTCCCAGG + Intergenic
1029080748 7:97972198-97972220 CTGCTTCTCCTGGGCCGCCGAGG + Intergenic
1029467679 7:100736592-100736614 CGGCTCCACCGGGGCCCCCGGGG + Exonic
1031748645 7:125540144-125540166 CTGTGTCACCCAGGCCTCCCAGG - Intergenic
1032090309 7:128908534-128908556 CTGCTGCCCAGGGGGCTCCCTGG + Exonic
1034531917 7:151701117-151701139 CTGCTCCAGTGGGGCTTCCCTGG - Intronic
1034547157 7:151796666-151796688 CTGAGTCACCGGCTCCTCCCAGG + Intronic
1035437159 7:158867734-158867756 CGGCCTCTCCTGGGCCTCCCCGG + Intronic
1035573165 8:687652-687674 CTGCCTCGCCTGGGCCGCCCGGG - Intronic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1036788776 8:11704251-11704273 CTGCAGCTCCGGGGGCTCCCAGG + Exonic
1039212685 8:35235318-35235340 CTGGCTCACCTGCGCCTCCCGGG + Intergenic
1039502940 8:38031227-38031249 CTGCTCCAGCAGCGCCTCCCGGG + Intronic
1049428131 8:142546514-142546536 CTGCTTCCCAGGGGCCTCCCAGG - Intergenic
1049552435 8:143266878-143266900 CTGCTTTCCAGGGGCGTCCCCGG - Intronic
1049592913 8:143470659-143470681 CTGCTGCACCCGGTCCTGCCAGG - Intronic
1049637505 8:143696934-143696956 CTGCCTCACCGGGCTCTGCCAGG - Intronic
1049850125 8:144826522-144826544 GTTTTTCACCTGGGCCTCCCTGG + Intergenic
1056674302 9:88660898-88660920 CTGCTTCACAGAGACTTCCCAGG - Intergenic
1056904430 9:90633008-90633030 CTCCTTCCCCAGGGCCTGCCTGG - Intronic
1057270171 9:93646102-93646124 CCGCACCACCAGGGCCTCCCAGG - Intronic
1057950315 9:99364547-99364569 CTGCTTCATAGGTGCCTCCCAGG - Intergenic
1059245266 9:112844274-112844296 CTGCTCCACCTGTTCCTCCCTGG - Intronic
1059448989 9:114358149-114358171 CATCTTCTCCGTGGCCTCCCTGG + Exonic
1060375383 9:123112024-123112046 CTGCCTCTCCAGGGCCTGCCAGG + Intronic
1060894350 9:127208163-127208185 CTGCTCCACTGGGGCCACCAAGG + Intronic
1061233142 9:129326639-129326661 CTGCTTCCCTGGCTCCTCCCAGG - Intergenic
1061540737 9:131276919-131276941 CTGCTTCGCCGCGGCCGCCGAGG + Intergenic
1061747330 9:132750065-132750087 CTGATGCATCAGGGCCTCCCAGG - Intronic
1061874713 9:133537875-133537897 CTGCTTCTCCCGGGGCTCCCTGG - Intronic
1062138457 9:134942316-134942338 CTGCTGGAGAGGGGCCTCCCAGG - Intergenic
1062421360 9:136484102-136484124 TTGCTGCGCCGGGCCCTCCCAGG + Exonic
1062427912 9:136514523-136514545 CTGCGTCCACGGGGCCTGCCGGG - Exonic
1185508435 X:645179-645201 CCGCTCCCCCGGAGCCTCCCAGG + Exonic
1186585597 X:10869972-10869994 CTGCTTCACCTCGCCCTCCATGG - Intergenic
1186896454 X:14008979-14009001 CAGCTGCACCGCGGCCTCCATGG + Exonic
1188441066 X:30215739-30215761 CGGCTTTACCGGAGCCTCTCAGG - Intronic
1191085561 X:56563855-56563877 CTGCGTCACCGCGGCCGCCATGG + Exonic
1196778246 X:119360438-119360460 CTGTTTGAGCGGGTCCTCCCAGG - Intergenic
1196928893 X:120661466-120661488 CTCCTCCACCGCAGCCTCCCAGG - Intergenic
1198618148 X:138480589-138480611 CTGCTTGACTGGAGCCTCCCAGG - Intergenic